CCL14 Rabbit Polyclonal Antibody

CCL14 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CCL14 Polyclonal Antibody

ABP58011-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
  • Applications tips:
Description: A polyclonal antibody for detection of CCL14 from Human. This CCL14 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93

CCL14 Polyclonal Antibody

A55419 100 µg
EUR 570.55
Description: kits suitable for this type of research

CCL14 Polyclonal Antibody

46832-100ul 100ul
EUR 252

CCL14 Polyclonal Antibody

46832-50ul 50ul
EUR 187

CCL14 Polyclonal Conjugated Antibody

C46832 100ul
EUR 397

Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

DLR-CCL14-Hu-48T 48T
EUR 498
  • Should the Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-C-Motif Ligand 14 (CCL14) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

DLR-CCL14-Hu-96T 96T
EUR 647
  • Should the Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-C-Motif Ligand 14 (CCL14) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

RD-CCL14-Hu-48Tests 48 Tests
EUR 500

Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

RD-CCL14-Hu-96Tests 96 Tests
EUR 692

Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

RDR-CCL14-Hu-48Tests 48 Tests
EUR 522

Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

RDR-CCL14-Hu-96Tests 96 Tests
EUR 724

CCL14 Antibody

43915-100ul 100ul
EUR 252

CCL14 Antibody

1-CSB-PA08947A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rabbit CCL14 ELISA Kit

ERTC0606 96Tests
EUR 521

CCL14 Polyclonal Antibody, HRP Conjugated

A55420 100 µg
EUR 570.55
Description: fast delivery possible

CCL14 Polyclonal Antibody, FITC Conjugated

A55421 100 µg
EUR 570.55
Description: reagents widely cited

CCL14 Polyclonal Antibody, Biotin Conjugated

A55422 100 µg
EUR 570.55
Description: Ask the seller for details

CCL14 Conjugated Antibody

C43915 100ul
EUR 397

Anti-CCL14 antibody

STJ98768 200 µl
EUR 197
Description: Rabbit polyclonal to CCL14.

CCL14 siRNA

20-abx910756
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CCL14

YF-PA14550 100 ug
EUR 403
Description: Rabbit polyclonal to CCL14

CCL14 Antibody, HRP conjugated

1-CSB-PA08947B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL14 Antibody, FITC conjugated

1-CSB-PA08947C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL14 Antibody, Biotin conjugated

1-CSB-PA08947D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCL14 cloning plasmid

CSB-CL613691HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 282
  • Sequence: atgaagatctccgtggctgccattcccttcttcctcctcatcaccatcgccctagggaccaagactgaatcctcctcacggggaccttaccacccctcagagtgctgcttcacctacactacctacaagatcccgcgtcagcggattatggattactatgagaccaacagccagtg
  • Show more
Description: A cloning plasmid for the CCL14 gene.

pCMV-SPORT6-CCL14

PVT19029 2 ug
EUR 231

Anti-CCL14 (1F12)

YF-MA15361 100 ug
EUR 363
Description: Mouse monoclonal to CCL14

Anti-CCL14 (3B12)

YF-MA15362 100 ug
EUR 363
Description: Mouse monoclonal to CCL14

Anti-CCL14/Hcc 1 Antibody

A07151 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CCL14 Antibody (CCL14) detection.tested for IHC in Human.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human)

4-PAB122Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14)

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human)

4-PAB122Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14)

Human CCL14 ELISA Kit

EHC0606 96Tests
EUR 521

Goat CCL14 ELISA Kit

EGTC0606 96Tests
EUR 521

Canine CCL14 ELISA Kit

ECC0606 96Tests
EUR 521

Chicken CCL14 ELISA Kit

ECKC0606 96Tests
EUR 521

Bovine CCL14 ELISA Kit

EBC0606 96Tests
EUR 521

Anserini CCL14 ELISA Kit

EAC0606 96Tests
EUR 521

CCL14 ELISA KIT|Human

EF000044 96 Tests
EUR 689

Porcine CCL14 ELISA Kit

EPC0606 96Tests
EUR 521

Rat CCL14 ELISA Kit

ERC0606 96Tests
EUR 521

Sheep CCL14 ELISA Kit

ESC0606 96Tests
EUR 521

HCC-1/CCL14, Human

HY-P7195 50ug
EUR 533

Mouse CCL14 ELISA Kit

EMC0606 96Tests
EUR 521

Monkey CCL14 ELISA Kit

EMKC0606 96Tests
EUR 521

HCC-1 (CCL14) Protein

20-abx260670
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

HCC-1 (CCL14) Protein

20-abx260679
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Human CCL14 shRNA Plasmid

20-abx954291
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCL14 protein (His tag)

80R-1688 100 ug
EUR 305
Description: Purified recombinant Human CCL14 protein

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC

4-PAB122Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Biotinylated

4-PAB122Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Biotin.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Cy3

4-PAB122Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Cy3.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), FITC

4-PAB122Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with FITC.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), HRP

4-PAB122Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with HRP.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), PE

4-PAB122Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with PE.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC

4-PAB122Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Biotinylated

4-PAB122Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Biotin.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Cy3

4-PAB122Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Cy3.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), FITC

4-PAB122Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with FITC.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), HRP

4-PAB122Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with HRP.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), PE

4-PAB122Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with PE.

Monoclonal CCL14 Antibody (monoclonal) (M01), Clone: 1F12

APG02470G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CCL14 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F12. This antibody is applicable in WB, E

Rabbit Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit

abx362515-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea Pig CCL14 ELISA Kit

EGC0606 96Tests
EUR 521

Recombinant Human HCC-1 (CCL14)

7-01894 2µg Ask for price

Recombinant Human HCC-1 (CCL14)

7-01895 10µg Ask for price

Recombinant Human HCC-1 (CCL14)

7-01896 1mg Ask for price

CCL14 ORF Vector (Human) (pORF)

ORF002036 1.0 ug DNA
EUR 95

CCL14 ELISA Kit (Human) (OKAN05050)

OKAN05050 96 Wells
EUR 792
Description: Description of target: This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

CCL14 ELISA Kit (Human) (OKCD07164)

OKCD07164 96 Wells
EUR 936
Description: Description of target: Recombinant Human HCC-1 (CCL14);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC-Cy7

4-PAB122Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC-Cy7.

Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC-Cy7

4-PAB122Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC-Cy7.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody

20-abx128557
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody

20-abx109618
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody

20-abx103116
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody

20-abx171679
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

CCL14 sgRNA CRISPR Lentivector set (Human)

K0389701 3 x 1.0 ug
EUR 339

HCC-1 (CCL14) (66 a.a.) Protein

20-abx260657
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant (E.Coli) Human HCC-1 (CCL14)

RP-1015 10 ug
EUR 286

HCC-1, CCL14 (66 a.a.), human

RC315-25A 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

HCC-1 Human Recombinant Protein (CCL14)

PROTQ16627-2 Regular: 10ug
EUR 317
Description: HCC-1 Human Recombinant produced in E.Coli is a single,non-glycosylated, polypeptide chain containing 72 amino acids and having a molecular mass of 8411 Dalton. ;The HCC-1 is purified by proprietary chromatographic techniques.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (Biotin)

20-abx105232
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (FITC)

20-abx106650
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (HRP)

20-abx108067
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (Biotin)

20-abx272091
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human CCL14/HCC-1

EK5484 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL14/HCC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CCL14/HCC-1 PicoKine ELISA Kit

EK1123 96 wells
EUR 425
Description: For quantitative detection of human CCL14 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CCL14 sgRNA CRISPR Lentivector (Human) (Target 1)

K0389702 1.0 ug DNA
EUR 154

CCL14 sgRNA CRISPR Lentivector (Human) (Target 2)

K0389703 1.0 ug DNA
EUR 154

CCL14 sgRNA CRISPR Lentivector (Human) (Target 3)

K0389704 1.0 ug DNA
EUR 154

Recombinant Human HCC-1 (CCL14) His Tag

7-01897 2µg Ask for price

Recombinant Human HCC-1 (CCL14) His Tag

7-01898 10µg Ask for price

Recombinant Human HCC-1 (CCL14) His Tag

7-01899 1mg Ask for price

CCL14/HCC-1/HCC-3, human recombinant

4275-10
EUR 229

CCL14/HCC-1/HCC-3, human recombinant

4275-1000
EUR 3932

CCL14/HCC-1/HCC-3, human recombinant

4275-50
EUR 566

Human C-C motif chemokine 14 (CCL14)

1-CSB-EP613691HU(F)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human C-C motif chemokine 14(CCL14) expressed in E.coli

CCL14 Protein Vector (Human) (pPB-C-His)

PV008141 500 ng
EUR 329

CCL14 Protein Vector (Human) (pPB-N-His)

PV008142 500 ng
EUR 329

CCL14 Protein Vector (Human) (pPM-C-HA)

PV008143 500 ng
EUR 329

CCL14 Protein Vector (Human) (pPM-C-His)

PV008144 500 ng
EUR 329

CCL14 3'UTR Luciferase Stable Cell Line

TU003759 1.0 ml
EUR 1394

CCL14 3'UTR GFP Stable Cell Line

TU053759 1.0 ml
EUR 1394

CCL14/HCC-1 ELISA Kit (Human) (OKBB00501)

OKBB00501 96 Wells
EUR 505
Description: Description of target: Chemokine (C-C motif) ligand 14 (CCL14) is a small cytokine belonging to the CC chemokine family. It is also commonly known as HCC-1. It is produced as a protein precursor that is processed to generate a mature active protein containing 74 amino acids that and is 46% identical in amino acid composition to CCL3 and CCL4. This chemokine is expressed in various tissues including spleen, bone marrow, liver, muscle, and gut. CCL14 activates monocytes, but does not induce their chemotaxis. In addition, HCC-1 enhanced the proliferation of CD34+ myeloid progenitor cells. It was as effective as MIP-1 alpha, but about 100-fold less potent. Human CCL14 is located on chromosome 17 within a cluster of other chemokines belonging to the CC family.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

CCL14 Chemi-Luminescent ELISA Kit (Human) (OKCD05561)

OKCD05561 96 Wells
EUR 1144
Description: Description of target: Recombinant Human HCC-1 (CCL14);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.54pg/mL

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CCL14 Rabbit Polyclonal Antibody