KIF1C Rabbit Polyclonal Antibody

KIF1C Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

KIF1C Polyclonal Antibody
ABP59046-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of KIF1C from Human, Mouse, Rat. This KIF1C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
KIF1C Polyclonal Antibody
ABP59046-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of KIF1C from Human, Mouse, Rat. This KIF1C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
KIF1C Polyclonal Antibody
ABP59046-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of KIF1C from Human, Mouse, Rat. This KIF1C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
KIF1C Polyclonal Antibody
ES8949-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KIF1C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
KIF1C Polyclonal Antibody
ES8949-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KIF1C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
KIF1C Rabbit pAb
A15786-100ul 100 ul
EUR 308
KIF1C Rabbit pAb
A15786-200ul 200 ul
EUR 459
KIF1C Rabbit pAb
A15786-20ul 20 ul
EUR 183
KIF1C Rabbit pAb
A15786-50ul 50 ul
EUR 223
KIF1C antibody
70R-1611 100 ug
EUR 377
Description: Rabbit polyclonal KIF1C antibody raised against the C terminal of KIF1C
KIF1C antibody
70R-18115 50 ul
EUR 435
Description: Rabbit polyclonal KIF1C antibody
KIF1C Antibody
36569-100ul 100ul
EUR 252
KIF1C Antibody
1-CSB-PA969739
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIF1C. Recognizes KIF1C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
KIF1C Antibody
1-CSB-PA175695
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIF1C. Recognizes KIF1C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
KIF1C Antibody
1-CSB-PA012320GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KIF1C. Recognizes KIF1C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Kif1c Antibody
1-CSB-PA012320LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is Unconjugated. Tested in the following application: ELISA
Kif1c Polyclonal Antibody, HRP Conjugated
A56664 100 µg
EUR 570.55
Description: Ask the seller for details
Kif1c Polyclonal Antibody, FITC Conjugated
A56665 100 µg
EUR 570.55
Description: The best epigenetics products
Kif1c Polyclonal Antibody, Biotin Conjugated
A56666 100 µg
EUR 570.55
Description: kits suitable for this type of research
Kif1c/ Rat Kif1c ELISA Kit
ELI-28101r 96 Tests
EUR 886
KIF1C Conjugated Antibody
C36569 100ul
EUR 397
anti- KIF1C antibody
FNab04556 100µg
EUR 505.25
  • Immunogen: kinesin family member 1C
  • Uniprot ID: O43896
  • Gene ID: 10749
  • Research Area: Cell Division and Proliferation, Developmental biology
Description: Antibody raised against KIF1C
Anti-KIF1C antibody
PAab04556 100 ug
EUR 355
Anti-KIF1C antibody
STJ118245 100 µl
EUR 277
Anti-KIF1C antibody
STJ190107 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KIF1C
Rat Kinesin-like protein KIF1C (Kif1c)
1-CSB-EP012320RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Kinesin-like protein KIF1C(Kif1c) expressed in E.coli
Rat Kinesin-like protein KIF1C (Kif1c)
1-CSB-YP012320RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Kinesin-like protein KIF1C(Kif1c) ,partial expressed in Yeast
KIF1C siRNA
20-abx902842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KIF1C siRNA
20-abx921600
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KIF1C siRNA
20-abx921601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Kif1c Antibody, HRP conjugated
1-CSB-PA012320LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA
Kif1c Antibody, FITC conjugated
1-CSB-PA012320LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA
Kif1c Antibody, Biotin conjugated
1-CSB-PA012320LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse Kinesin- like protein KIF1C, Kif1c ELISA KIT
ELI-15858m 96 Tests
EUR 865
Human Kinesin- like protein KIF1C, KIF1C ELISA KIT
ELI-08130h 96 Tests
EUR 824
KIF1C Blocking Peptide
33R-3283 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF1C antibody, catalog no. 70R-1611
KIF1C cloning plasmid
CSB-CL012320HU-10ug 10ug
EUR 1214
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3312
  • Sequence: atggctggtgcctcggtgaaagtggcagtgagggttcggccctttaacgcccgtgagaccagccaggatgccaagtgtgtggtcagcatgcagggcaacaccacctccatcatcaatcctaaacagagcaaggatgcccccaaaagcttcacctttgactactcctactggtcac
  • Show more
Description: A cloning plasmid for the KIF1C gene.
Anti-KIF1C (1F12)
YF-MA17471 100 ug
EUR 363
Description: Mouse monoclonal to KIF1C
Kinesin-like Protein KIF1C (Phospho-Ser1092) Polyclonal Conjugated Antibody
C12459 100ul
EUR 397
KIF1C ELISA KIT|Human
EF010514 96 Tests
EUR 689
Rat KIF1C shRNA Plasmid
20-abx987106
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KIF1C shRNA Plasmid
20-abx957325
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse KIF1C shRNA Plasmid
20-abx971181
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Kinesin Family Member 1C (KIF1C) Antibody
20-abx214197
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kinesin-like Protein KIF1C (pS1092) Antibody
abx216454-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody
20-abx110446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody
20-abx113383
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody
abx146469-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody
20-abx241556
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody
abx234556-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Kinesin-like Protein KIF1C (Phospho-Ser1092) Antibody
12459-100ul 100ul
EUR 252
Kinesin-like Protein KIF1C (Phospho-Ser1092) Antibody
12459-50ul 50ul
EUR 187
Kinesin Family Member 1C (KIF1C) Antibody (Biotin)
20-abx106168
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody (FITC)
20-abx107581
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kinesin Family Member 1C (KIF1C) Antibody (HRP)
20-abx109000
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phospho-Kinesin-like Protein KIF1C (Ser1092) Antibody
AF8091 200ul
EUR 376
Description: Kinesin-like Protein KIF1C (Phospho-Ser1092) Antibody detects endogenous levels of Kinesin-like Protein KIF1C only when phosphorylated at Ser1092.
Kinesin- like Protein KIF1C (Phospho- Ser1092) Antibody
ABF8091 100 ug
EUR 438
Kif1c ORF Vector (Rat) (pORF)
ORF069044 1.0 ug DNA
EUR 506
KIF1C ORF Vector (Human) (pORF)
ORF005664 1.0 ug DNA
EUR 95
Kif1c ORF Vector (Mouse) (pORF)
ORF048559 1.0 ug DNA
EUR 506
Kif1c sgRNA CRISPR Lentivector set (Rat)
K6954601 3 x 1.0 ug
EUR 339
Kif1c sgRNA CRISPR Lentivector set (Mouse)
K3996901 3 x 1.0 ug
EUR 339
KIF1C sgRNA CRISPR Lentivector set (Human)
K1145701 3 x 1.0 ug
EUR 339
Kif1c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6954602 1.0 ug DNA
EUR 154
Kif1c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6954603 1.0 ug DNA
EUR 154
Kif1c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6954604 1.0 ug DNA
EUR 154
Kif1c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3996902 1.0 ug DNA
EUR 154
Kif1c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3996903 1.0 ug DNA
EUR 154
Kif1c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3996904 1.0 ug DNA
EUR 154
KIF1C sgRNA CRISPR Lentivector (Human) (Target 1)
K1145702 1.0 ug DNA
EUR 154
KIF1C sgRNA CRISPR Lentivector (Human) (Target 2)
K1145703 1.0 ug DNA
EUR 154
KIF1C sgRNA CRISPR Lentivector (Human) (Target 3)
K1145704 1.0 ug DNA
EUR 154
KIF1C Protein Vector (Human) (pPB-C-His)
PV022653 500 ng
EUR 329
KIF1C Protein Vector (Human) (pPB-N-His)
PV022654 500 ng
EUR 329
KIF1C Protein Vector (Human) (pPM-C-HA)
PV022655 500 ng
EUR 329
KIF1C Protein Vector (Human) (pPM-C-His)
PV022656 500 ng
EUR 329
KIF1C Protein Vector (Rat) (pPB-C-His)
PV276174 500 ng
EUR 1191
KIF1C Protein Vector (Rat) (pPB-N-His)
PV276175 500 ng
EUR 1191
KIF1C Protein Vector (Rat) (pPM-C-HA)
PV276176 500 ng
EUR 1191
KIF1C Protein Vector (Rat) (pPM-C-His)
PV276177 500 ng
EUR 1191
KIF1C Protein Vector (Mouse) (pPB-C-His)
PV194234 500 ng
EUR 1065
KIF1C Protein Vector (Mouse) (pPB-N-His)
PV194235 500 ng
EUR 1065
KIF1C Protein Vector (Mouse) (pPM-C-HA)
PV194236 500 ng
EUR 1065
KIF1C Protein Vector (Mouse) (pPM-C-His)
PV194237 500 ng
EUR 1065
Kif1c 3'UTR Luciferase Stable Cell Line
TU110554 1.0 ml Ask for price
Kif1c 3'UTR GFP Stable Cell Line
TU160554 1.0 ml Ask for price
Kif1c 3'UTR Luciferase Stable Cell Line
TU206687 1.0 ml Ask for price
Kif1c 3'UTR GFP Stable Cell Line
TU256687 1.0 ml Ask for price
KIF1C 3'UTR GFP Stable Cell Line
TU061750 1.0 ml
EUR 2333
KIF1C 3'UTR Luciferase Stable Cell Line
TU011750 1.0 ml
EUR 2333
Human Kinesin Family Member 1C (KIF1C) ELISA Kit
abx388142-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Phospho-Kinesin-like Protein KIF1C (Ser1092) Blocking Peptide
AF8091-BP 1mg
EUR 195
KIF1C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV671449 1.0 ug DNA
EUR 1355
KIF1C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV671453 1.0 ug DNA
EUR 1355
KIF1C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV671454 1.0 ug DNA
EUR 1355
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

KIF1C Rabbit Polyclonal Antibody