OGT Rabbit Polyclonal Antibody

OGT Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

OGT Polyclonal Antibody
ABP59641-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OGT protein
  • Applications tips:
Description: A polyclonal antibody for detection of OGT from Human, Mouse, Rat. This OGT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OGT protein

OGT Polyclonal Antibody
ABP59641-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OGT protein
  • Applications tips:
Description: A polyclonal antibody for detection of OGT from Human, Mouse, Rat. This OGT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OGT protein

OGT Polyclonal Antibody
A56310 100 µg
EUR 570.55
Description: fast delivery possible

OGT Rabbit mAb
A3501-100ul 100 ul
EUR 410

OGT Rabbit mAb
A3501-200ul 200 ul
EUR 571

OGT Rabbit mAb
A3501-20ul 20 ul
EUR 221

OGT Rabbit mAb
A3501-50ul 50 ul
EUR 287

OGT Rabbit pAb
A1990-100ul 100 ul
EUR 308

OGT Rabbit pAb
A1990-200ul 200 ul
EUR 459

OGT Rabbit pAb
A1990-20ul 20 ul
EUR 183

OGT Rabbit pAb
A1990-50ul 50 ul
EUR 223

OGT Rabbit pAb
A2214-100ul 100 ul
EUR 308

OGT Rabbit pAb
A2214-200ul 200 ul
EUR 459

OGT Rabbit pAb
A2214-20ul 20 ul
EUR 183

OGT Rabbit pAb
A2214-50ul 50 ul
EUR 223

OGT Antibody
ABD6740 100 ug
EUR 438

OGT Antibody
49799-100ul 100ul
EUR 333

OGT Antibody
49799-50ul 50ul
EUR 239

OGT Antibody
43015-100ul 100ul
EUR 252

OGT Antibody
32540-100ul 100ul
EUR 252

OGT antibody
70R-19034 50 ul
EUR 435
Description: Rabbit polyclonal OGT antibody

OGT antibody
70R-2046 50 ug
EUR 467
Description: Rabbit polyclonal OGT antibody

OGT Antibody
DF6740 200ul
EUR 304
Description: OGT Antibody detects endogenous levels of total OGT.

OGT Antibody
1-CSB-PA016315GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OGT. Recognizes OGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

OGT Antibody
1-CSB-PA016315LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGT. Recognizes OGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal Goat Anti-OGT Antibody
APG03363G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-OGT . This antibody is tested and proven to work in the following applications:

OGT Polyclonal Antibody, HRP Conjugated
A56311 100 µg
EUR 570.55
Description: reagents widely cited

OGT Polyclonal Antibody, FITC Conjugated
A56312 100 µg
EUR 570.55
Description: Ask the seller for details

OGT Polyclonal Antibody, Biotin Conjugated
A56313 100 µg
EUR 570.55
Description: The best epigenetics products

Polyclonal OGT / O-GLCNAC Antibody (Internal)
AMM06886G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human OGT / O-GLCNAC (Internal). This antibody is tested and proven to work in the following applications:

OGT Conjugated Antibody
C43015 100ul
EUR 397

OGT Conjugated Antibody
C49799 100ul
EUR 397

OGT Conjugated Antibody
C32540 100ul
EUR 397

anti- OGT antibody
FNab05981 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
  • Uniprot ID: O15294
  • Gene ID: 8473
  • Research Area: Signal Tra
  • Show more
Description: Antibody raised against OGT

Anti-OGT antibody
PAab05981 100 ug
EUR 355

Anti-OGT antibody
STJ99662 200 µl
EUR 197
Description: Rabbit polyclonal to OGT.

Anti-OGT Antibody
STJ501999 100 µg
EUR 476

Anti-OGT antibody
STJ71101 100 µg
EUR 359

Anti-OGT antibody
STJ24862 100 µl
EUR 277
Description: This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-OGT antibody
STJ111128 100 µl
EUR 277
Description: This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Ogt/ Rat Ogt ELISA Kit
ELI-44586r 96 Tests
EUR 886

OGT siRNA
20-abx903739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OGT 2115
B7157-1 1 mg
EUR 161

OGT 2115
B7157-10 10 mg
EUR 292

OGT siRNA
20-abx926814
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OGT siRNA
20-abx926815
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OGT Antibody, HRP conjugated
1-CSB-PA016315LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGT. Recognizes OGT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OGT Antibody, FITC conjugated
1-CSB-PA016315LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGT. Recognizes OGT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OGT Antibody, Biotin conjugated
1-CSB-PA016315LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGT. Recognizes OGT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-OGT Monoclonal Antibody
M00474 100ug
EUR 397
Description: Rabbit Monoclonal OGT Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-OGT Antibody (Biotin)
STJ502000 100 µg
EUR 586

Anti-OGT Antibody (FITC)
STJ502001 100 µg
EUR 586

OGT cloning plasmid
CSB-CL016315HU-10ug 10ug
EUR 1115
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3111
  • Sequence: atggcgtcttccgtgggcaacgtggccgacagcacagggttagctgagttggcacatcgagaatatcaggcaggagattttgaggcagctgagagacactgcatgcagctctggagacaagagccagacaatactggtgtgcttttattactttcatctatacacttccagtgtc
  • Show more
Description: A cloning plasmid for the OGT gene.

OGT Blocking Peptide
33R-1533 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OGT antibody, catalog no. 70R-2046

OGT Blocking Peptide
DF6740-BP 1mg
EUR 195

Mouse OGT shRNA Plasmid
20-abx979904
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat OGT shRNA Plasmid
20-abx985284
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OGT ELISA KIT
ELI-14895h 96 Tests
EUR 824

OGT ELISA KIT|Human
EF001431 96 Tests
EUR 689

Mouse Ogt ELISA KIT
ELI-37620m 96 Tests
EUR 865

Human OGT shRNA Plasmid
20-abx955555
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OGT ORF Vector (Human) (pORF)
ORF007362 1.0 ug DNA
EUR 95

Ogt ORF Vector (Rat) (pORF)
ORF071704 1.0 ug DNA
EUR 506

Ogt ORF Vector (Mouse) (pORF)
ORF051950 1.0 ug DNA
EUR 506

OGT ELISA Kit (Human) (OKCD01956)
OKCD01956 96 Wells
EUR 831
Description: Description of target: This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively, spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 28 pg/mL

OGT ELISA Kit (Human) (OKAN06275)
OKAN06275 96 Wells
EUR 792
Description: Description of target: This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.59 ng/mL

OGT ELISA Kit (Rat) (OKCA01950)
OKCA01950 96 Wells
EUR 846
Description: Description of target: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in cytoplasmic and nuclear proteins resulting in their modification with a beta-linked N-acetylglucosamine (O-GlcNAc). Glycosylates a large and diverse number of proteins including histone H2B, AKT1, EZH2, PFKL, KMT2E/MLL5, MAPT/TAU and HCFC1. Can regulate their cellular processes via cross-talk between glycosylation and phosphorylation or by affecting proteolytic processing. Involved in insulin resistance in muscle and adipocyte cells via glycosylating insulin signaling components and inhibiting the 'Thr-308' phosphorylation of AKT1, enhancing IRS1 phosphorylation and attenuating insulin signaling. Involved in glycolysis regulation by mediating glycosylation of 6-phosphofructokinase PFKL, inhibiting its activity. Component of a THAP1/THAP3-HCFC1-OGT complex that is required for the regulation of the transcriptional activity of RRM1. Plays a key role in chromatin structure by mediating O-GlcNAcylation of 'Ser-112' of histone H2B: recruited to CpG-rich transcription start sites of active genes via its interaction with TET proteins (TET1, TET2 or TET3). As part of the NSL complex indirectly involved in acetylation of nucleosomal histone H4 on several lysine residues. O-GlcNAcylation of 'Ser-75' of EZH2 increases its stability, and facilitating the formation of H3K27me3 by the PRC2/EED-EZH2 complex. Regulates circadian oscillation of the clock genes and glucose homeostasis in the liver. Stabilizes clock proteins ARNTL/BMAL1 and CLOCK through O-glycosylation, which prevents their ubiquitination and subsequent degradation. Promotes the CLOCK-ARNTL/BMAL1-mediated transcription of genes in the negative loop of the circadian clock such as PER1/2 and CRY1/2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 10.94 pg/mL

OGT ELISA Kit (Human) (OKCA02153)
OKCA02153 96 Wells
EUR 833
Description: Description of target: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in cytoplasmic and nuclear proteins resulting in their modification with a beta-linked N-acetylglucosamine (O-GlcNAc). Glycosylates a large and diverse number of proteins including histone H2B, AKT1, EZH2, PFKL, KMT2E/MLL5, MAPT/TAU and HCFC1. Can regulate their cellular processes via cross-talk between glycosylation and phosphorylation or by affecting proteolytic processing. Involved in insulin resistance in muscle and adipocyte cells via glycosylating insulin signaling components and inhibiting the 'Thr-308' phosphorylation of AKT1, enhancing IRS1 phosphorylation and attenuating insulin signaling. Involved in glycolysis regulation by mediating glycosylation of 6-phosphofructokinase PFKL, inhibiting its activity. Component of a THAP1/THAP3-HCFC1-OGT complex that is required for the regulation of the transcriptional activity of RRM1. Plays a key role in chromatin structure by mediating O-GlcNAcylation of 'Ser-112' of histone H2B: recruited to CpG-rich transcription start sites of active genes via its interaction with TET proteins (TET1, TET2 or TET3). As part of the NSL complex indirectly involved in acetylation of nucleosomal histone H4 on several lysine residues. O-GlcNAcylation of 'Ser-75' of EZH2 increases its stability, and facilitating the formation of H3K27me3 by the PRC2/EED-EZH2 complex. Regulates circadian oscillation of the clock genes and glucose homeostasis in the liver. Stabilizes clock proteins ARNTL/BMAL1 and CLOCK through O-glycosylation, which prevents their ubiquitination and subsequent degradation. Promotes the CLOCK-ARNTL/BMAL1-mediated transcription of genes in the negative loop of the circadian clock such as PER1/2 and CRY1/2.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.38 pg/mL

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
20-abx126290
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
20-abx109393
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
20-abx001621
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
20-abx141655
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
abx216038-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
abx431038-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody
abx235981-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-OGT/O-Linked N-Acetylglucosamine Transferase Antibody
PB9767 100ug/vial
EUR 334

OGT sgRNA CRISPR Lentivector set (Human)
K1480601 3 x 1.0 ug
EUR 339

Ogt sgRNA CRISPR Lentivector set (Mouse)
K4387601 3 x 1.0 ug
EUR 339

Ogt sgRNA CRISPR Lentivector set (Rat)
K6881101 3 x 1.0 ug
EUR 339

pLKO.1-OGT shRNA-1 Plasmid
PVTB00887-3a 2 ug
EUR 356

pLKO.1-OGT shRNA-2 Plasmid
PVTB00887-3b 2 ug
EUR 356

pLKO.1-OGT shRNA-4 Plasmid
PVTB00887-3d 2 ug
EUR 356

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody (HRP)
20-abx108888
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody (Biotin)
20-abx106055
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

O-Linked N-Acetylglucosamine (GlcNAc) Transferase (OGT) Antibody (FITC)
20-abx107469
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

OGT sgRNA CRISPR Lentivector (Human) (Target 1)
K1480602 1.0 ug DNA
EUR 154

OGT sgRNA CRISPR Lentivector (Human) (Target 2)
K1480603 1.0 ug DNA
EUR 154

OGT sgRNA CRISPR Lentivector (Human) (Target 3)
K1480604 1.0 ug DNA
EUR 154

Ogt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4387602 1.0 ug DNA
EUR 154

Ogt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4387603 1.0 ug DNA
EUR 154

Ogt sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4387604 1.0 ug DNA
EUR 154

Ogt sgRNA CRISPR Lentivector (Rat) (Target 1)
K6881102 1.0 ug DNA
EUR 154

Ogt sgRNA CRISPR Lentivector (Rat) (Target 2)
K6881103 1.0 ug DNA
EUR 154

Ogt sgRNA CRISPR Lentivector (Rat) (Target 3)
K6881104 1.0 ug DNA
EUR 154

pLKO.1-OGT shRNA-3(NC) Plasmid
PVTB00887-3c 2 ug
EUR 356

OGT Protein Vector (Human) (pPB-C-His)
PV029445 500 ng
EUR 329

OGT Protein Vector (Human) (pPB-N-His)
PV029446 500 ng
EUR 329

OGT Protein Vector (Human) (pPM-C-HA)
PV029447 500 ng
EUR 329

OGT Protein Vector (Human) (pPM-C-His)
PV029448 500 ng
EUR 329

OGT Protein Vector (Mouse) (pPB-C-His)
PV207798 500 ng
EUR 1065

OGT Protein Vector (Mouse) (pPB-N-His)
PV207799 500 ng
EUR 1065

OGT Protein Vector (Mouse) (pPM-C-HA)
PV207800 500 ng
EUR 1065

OGT Protein Vector (Mouse) (pPM-C-His)
PV207801 500 ng
EUR 1065

OGT Protein Vector (Rat) (pPB-C-His)
PV286814 500 ng
EUR 1191

OGT Protein Vector (Rat) (pPB-N-His)
PV286815 500 ng
EUR 1191

OGT Protein Vector (Rat) (pPM-C-HA)
PV286816 500 ng
EUR 1191

OGT Protein Vector (Rat) (pPM-C-His)
PV286817 500 ng
EUR 1191

Ogt 3'UTR GFP Stable Cell Line
TU164535 1.0 ml Ask for price

OGT 3'UTR Luciferase Stable Cell Line
TU016233 1.0 ml
EUR 1521

Ogt 3'UTR Luciferase Stable Cell Line
TU114535 1.0 ml Ask for price

OGT 3'UTR GFP Stable Cell Line
TU066233 1.0 ml
EUR 1521

Ogt 3'UTR GFP Stable Cell Line
TU264388 1.0 ml Ask for price

Ogt 3'UTR Luciferase Stable Cell Line
TU214388 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

OGT Rabbit Polyclonal Antibody

 

Apex Business WordPress Theme | Designed by Crafthemes