PKN1 Rabbit Polyclonal Antibody

PKN1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

PKN1 Polyclonal Antibody
ES8989-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PKN1 Polyclonal Antibody
ABP59926-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ABP59926-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ABP59926-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-48T 48T
EUR 479
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-96T 96T
EUR 621
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-48Tests 48 Tests
EUR 478
Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-96Tests 96 Tests
EUR 662
Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-48Tests 48 Tests
EUR 500
Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-96Tests 96 Tests
EUR 692
PKN1 Rabbit pAb
A0553-100ul 100 ul
EUR 308
PKN1 Rabbit pAb
A0553-200ul 200 ul
EUR 459
PKN1 Rabbit pAb
A0553-20ul 20 ul
EUR 183
PKN1 Rabbit pAb
A0553-50ul 50 ul
EUR 223
PKN1 antibody
70R-50256 100 ul
EUR 244
Description: Purified Polyclonal PKN1 antibody
PKN1 Antibody
ABD4790 100 ug
EUR 438
PKN1 Antibody
48392-100ul 100ul
EUR 333
PKN1 Antibody
48392-50ul 50ul
EUR 239
PKN1 Antibody
DF4790 200ul
EUR 304
Description: PKN1 Antibody detects endogenous levels of total PKN1.
PKN1 Antibody
1-CSB-PA030259
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Rabbit PKN1 ELISA Kit
ERTP0125 96Tests
EUR 521
PKN1 Conjugated Antibody
C48392 100ul
EUR 397
PKN1/PRK1 Antibody
35295-100ul 100ul
EUR 252
PKN1/PRK1 Antibody
35295-50ul 50ul
EUR 187
Anti-PKN1 antibody
STJ110991 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed.
Anti-PKN1 antibody
STJ190147 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PKN1
Pkn1/ Rat Pkn1 ELISA Kit
ELI-37289r 96 Tests
EUR 886
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human)
4-PAA501Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1)
PKN1 siRNA
20-abx904045
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PKN1 siRNA
20-abx928745
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PKN1 siRNA
20-abx928746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PKN1
YF-PA13997 50 ug
EUR 363
Description: Mouse polyclonal to PKN1
anti-PKN1
YF-PA13998 100 ug
EUR 403
Description: Rabbit polyclonal to PKN1
anti-PKN1
YF-PA27338 100 ul
EUR 403
Description: Rabbit polyclonal to PKN1
PKN1/PRK1 Conjugated Antibody
C35295 100ul
EUR 397
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC
4-PAA501Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Biotinylated
4-PAA501Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Biotin.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Cy3
4-PAA501Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Cy3.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), FITC
4-PAA501Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with FITC.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), HRP
4-PAA501Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with HRP.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), PE
4-PAA501Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with PE.
Rabbit Protein Kinase N1 (PKN1) ELISA Kit
abx362392-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
PKN1 Blocking Peptide
20-abx063131
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
PKN1 Blocking Peptide
DF4790-BP 1mg
EUR 195
PKN1 cloning plasmid
CSB-CL623082HU-10ug 10ug
EUR 902
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
  • Show more
Description: A cloning plasmid for the PKN1 gene.
Anti-PKN1 (1B10)
YF-MA14890 100 ug
EUR 363
Description: Mouse monoclonal to PKN1
Anti-PKN1 (1A4)
YF-MA14891 100 ug
EUR 363
Description: Mouse monoclonal to PKN1
Monoclonal PKN1 Antibody, Clone: EPR3238
AMM07214G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC
Monoclonal PKN1 Antibody, Clone: 4H10B1
AMM03009G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E
Protein Kinase N1 (PKN1) Antibody
20-abx135704
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Antibody
20-abx101658
  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protein Kinase N1 (PKN1) Antibody
20-abx008827
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Antibody
20-abx174267
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Antibody for Human PKN1 (pThr774)
SPC-1065D 0.1ml
EUR 354
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 655.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 680.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 700.
Antibody for Human PKN1 (pThr774)
SPC-1065D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Alkaline Phosphatase.
Antibody for Human PKN1 (pThr774)
SPC-1065D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC .
Antibody for Human PKN1 (pThr774)
SPC-1065D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC/Cy7.
Antibody for Human PKN1 (pThr774)
SPC-1065D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Biotin.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 350.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 405.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 488.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 633.
Antibody for Human PKN1 (pThr774)
SPC-1065D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to FITC.
Antibody for Human PKN1 (pThr774)
SPC-1065D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to HRP.
Antibody for Human PKN1 (pThr774)
SPC-1065D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PE/ATTO 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PerCP.
Antibody for Human PKN1 (pThr774)
SPC-1065D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to RPE .
Antibody for Human PKN1 (pThr774)
SPC-1065D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Streptavidin.
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC-Cy7
4-PAA501Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC-Cy7.
Mouse PKN1 shRNA Plasmid
20-abx983453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat PKN1 shRNA Plasmid
20-abx985442
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PKN1 ELISA Kit
EHP0125 96Tests
EUR 521
Goat PKN1 ELISA Kit
EGTP0125 96Tests
EUR 521
Bovine PKN1 ELISA Kit
EBP0125 96Tests
EUR 521
Canine PKN1 ELISA Kit
ECP0125 96Tests
EUR 521
Anserini PKN1 ELISA Kit
EAP0125 96Tests
EUR 521
PKN1 ELISA KIT|Human
EF005461 96 Tests
EUR 689
Porcine PKN1 ELISA Kit
EPP0125 96Tests
EUR 521
Rat PKN1 ELISA Kit
ERP0125 96Tests
EUR 521
Mouse PKN1 ELISA Kit
EMP0125 96Tests
EUR 521
Human PKN1 shRNA Plasmid
20-abx953755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
abx149738-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
20-abx015170
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
20-abx327640
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase N1 (PKN1) Antibody
abx224112-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Guinea Pig PKN1 ELISA Kit
EGP0125 96Tests
EUR 521
PKN1 ORF Vector (Human) (pORF)
ORF007881 1.0 ug DNA
EUR 95
Pkn1 ORF Vector (Rat) (pORF)
ORF073569 1.0 ug DNA
EUR 506
Pkn1 ORF Vector (Mouse) (pORF)
ORF054151 1.0 ug DNA
EUR 506
Pkn1 ORF Vector (Mouse) (pORF)
ORF054152 1.0 ug DNA
EUR 506
Recombinant Protein Kinase N1 (PKN1)
4-RPA501Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16512
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.9kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Protein Kinase N1 expressed in: E.coli
PKN1 ELISA Kit (Human) (OKCD00803)
OKCD00803 96 Wells
EUR 792
Description: Description of target: PKC-related serine/threonine-protein kinase involved in various processes such as regulation of the intermediate filaments of the actin cytoskeleton, cell migration, tumor cell invasion and transcription regulation. Part of a signaling cascade that begins with the activation of the adrenergic receptor ADRA1B and leads to the activation of MAPK14. Regulates the cytoskeletal network by phosphorylating proteins such as VIM and neurofilament proteins NEFH, NEFL and NEFM, leading to inhibit their polymerization. Phosphorylates 'Ser-575', 'Ser-637' and 'Ser-669' of MAPT/Tau, lowering its ability to bind to microtubules, resulting in disruption of tubulin assembly. Acts as a key coactivator of androgen receptor (ANDR)-dependent transcription, by being recruited to ANDR target genes and specifically mediating phosphorylation of 'Thr-11' of histone H3 (H3T11ph), a specific tag for epigenetic transcriptional activation that promotes demethylation of histone H3 'Lys-9' (H3K9me) by KDM4C/JMJD2C. Phosphorylates HDAC5, HDAC7 and HDAC9, leading to impair their import in the nucleus. Phosphorylates 'Thr-38' of PPP1R14A, 'Ser-159', 'Ser-163' and 'Ser-170' of MARCKS, and GFAP. Able to phosphorylate RPS6 in vitro.11 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"PRK1 phosphorylates MARCKS at the PKC sites: serine 152, serine 156 and serine 163."_x005F_x005F_x000D_Palmer R.H., Schonwasser D.C., Rahman D., Pappin D.J., Herget T., Parker P.J._x005F_x005F_x000D_FEBS Lett. 378:281-285(1996) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.8"PKN associates and phosphorylates the head-rod domain of neurofilament protein."_x005F_x005F_x000D_Mukai H., Toshimori M., Shibata H., Kitagawa M., Shimakawa M., Miyahara M., Sunakawa H., Ono Y._x005F_x005F_x000D_J. Biol. Chem. 271:9816-9822(1996) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.10"Domain-specific phosphorylation of vimentin and glial fibrillary acidic protein by PKN."_x005F_x005F_x000D_Matsuzawa K., Kosako H., Inagaki N., Shibata H., Mukai H., Ono Y., Amano M., Kaibuchi K., Matsuura Y., Azuma I., Inagaki M._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 234:621-625(1997) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.14"Phosphorylation of tau is regulated by PKN."_x005F_x005F_x000D_Taniguchi T., Kawamata T., Mukai H., Hasegawa H., Isagawa T., Yasuda M., Hashimoto T., Terashima A., Nakai M., Mori H., Ono Y., Tanaka C._x005F_x005F_x000D_J. Biol. Chem. 276:10025-10031(2001) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.15"A novel inducible transactivation domain in the androgen receptor: implications for PRK in prostate cancer."_x005F_x005F_x000D_Metzger E., Muller J.M., Ferrari S., Buettner R., Schule R._x005F_x005F_x000D_EMBO J. 22:270-280(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH ANDR.Ref.19"Rho GTPases regulate PRK2/PKN2 to control entry into mitosis and exit from cytokinesis."_x005F_x005F_x000D_Schmidt A., Durgan J., Magalhaes A., Hall A._x005F_x005F_x000D_EMBO J. 26:1624-1636(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, PHOSPHORYLATION, SUBCELLULAR LOCATION.Ref.22"Phosphorylation of histone H3 at threonine 11 establishes a novel chromatin mark for transcriptional regulation."_x005F_x005F_x000D_Metzger E., Yin N., Wissmann M., Kunowska N., Fischer K., Friedrichs N., Patnaik D., Higgins J.M., Potier N., Scheidtmann K.H., Buettner R., Schule R._x005F_x005F_x000D_Nat. Cell Biol. 10:53-60(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, CATALYTIC ACTIVITY, MUTAGENESIS OF LYS-644.Ref.27"Protein kinase C-related kinase targets nuclear localization signals in a subset of class IIa histone deacetylases."_x005F_x005F_x000D_Harrison B.C., Huynh K., Lundgaard G.L., Helmke S.M., Perryman M.B., McKinsey T.A._x005F_x005F_x000D_FEBS Lett. 584:1103-1110(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, BIOPHYSICOCHEMICAL PROPERTIES.Ref.31"A-kinase anchoring protein (AKAP)-Lbc anchors a PKN-based signaling complex involved in alpha1-adrenergic receptor-induced p38 activation."_x005F_x005F_x000D_Cariolato L., Cavin S., Diviani D._x005F_x005F_x000D_J. Biol. Chem. 286:7925-7937(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, IDENTIFICATION IN A COMPLEX WITH AKAP13; MAPK14; ZAK AND MAP2K3.Ref.32"Regulatory domain selectivity in the cell-type specific PKN-dependence of cell migration."_x005F_x005F_x000D_Lachmann S., Jevons A., De Rycker M., Casamassima A., Radtke S., Collazos A., Parker P.J._x005F_x005F_x000D_PLoS ONE 6:E21732-E21732(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CELL MIGRATION, TISSUE SPECIFICITY.Ref.41"Structure of an SspH1-PKN1 complex reveals the basis for host substrate recognition and mechanism of activation for a bacterial E3 ubiquitin ligase."_x005F_x005F_x000D_Keszei A.F., Tang X., McCormick C., Zeqiraj E., Rohde J.R., Tyers M., Sicheri F._x005F_x005F_x000D_Mol. Cell. Biol. 34:362-373(2014) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.90 ANGSTROMS) OF 122-199 IN COMPLEX WITH SALMONELLA SSPH1, UBIQUITINATION (MICROBIAL INFECTION), MUTAGENESIS OF ARG-181 AND ARG-185, FUNCTION AS ANDROGEN RECEPTOR COACTIVATOR, INTERACTION WITH SALMONELLA SSPH1 (MICROBIAL INFECTION). ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL
PKN1 ELISA Kit (Mouse) (OKEI00529)
OKEI00529 96 Wells
EUR 767
Description: Description of target: PKC-related serine/threonine-protein kinase involved in various processes such as regulation of the intermediate filaments of the actin cytoskeleton, cell migration, tumor cell invasion and transcription regulation. Part of a signaling cascade that begins with the activation of the adrenergic receptor ADRA1B and leads to the activation of MAPK14. Regulates the cytoskeletal network by phosphorylating proteins such as VIM and neurofilament proteins NEFH, NEFL and NEFM, leading to inhibit their polymerization. Phosphorylates 'Ser-575', 'Ser-637' and 'Ser-669' of MAPT/Tau, lowering its ability to bind to microtubules, resulting in disruption of tubulin assembly. Acts as a key coactivator of androgen receptor (ANDR)-dependent transcription, by being recruited to ANDR target genes and specifically mediating phosphorylation of 'Thr-11' of histone H3 (H3T11ph), a specific tag for epigenetic transcriptional activation that promotes demethylation of histone H3 'Lys-9' (H3K9me) by KDM4C/JMJD2C. Phosphorylates HDAC5, HDAC7 and HDAC9, leading to impair their import in the nucleus. Phosphorylates 'Thr-38' of PPP1R14A, 'Ser-159', 'Ser-163' and 'Ser-170' of MARCKS, and GFAP. Able to phosphorylate RPS6 in vitro.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL
PKN1 ELISA Kit (Rat) (OKEI00825)
OKEI00825 96 Wells
EUR 767
Description: Description of target: PKC-related serine/threonine-protein kinase involved in various processes such as regulation of the intermediate filaments of the actin cytoskeleton, cell migration, tumor cell invasion and transcription regulation . Part of a signaling cascade that begins with the activation of the adrenergic receptor ADRA1B and leads to the activation of MAPK14.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL
Human Protein Kinase N1 (PKN1) Protein
20-abx068758
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
PKN1 sgRNA CRISPR Lentivector set (Human)
K1657401 3 x 1.0 ug
EUR 339
Pkn1 sgRNA CRISPR Lentivector set (Mouse)
K4951801 3 x 1.0 ug
EUR 339
Pkn1 sgRNA CRISPR Lentivector set (Rat)
K6794601 3 x 1.0 ug
EUR 339
Monkey Protein Kinase N1 (PKN1) ELISA Kit
abx359750-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Protein Kinase N1 (PKN1) ELISA Kit
abx361492-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Protein Kinase N1 (PKN1) ELISA Kit
20-abx152858
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Protein Kinase N1 (PKN1) ELISA Kit
abx351632-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Protein Kinase N1 (PKN1) ELISA Kit
abx353005-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Protein Kinase N1 (PKN1) ELISA Kit
abx353885-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Chicken Protein Kinase N1 (PKN1) ELISA Kit
abx356286-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Protein Kinase N1 (PKN1) CLIA Kit
20-abx491560
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
PKN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1657402 1.0 ug DNA
EUR 154
PKN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1657403 1.0 ug DNA
EUR 154
PKN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1657404 1.0 ug DNA
EUR 154
Human Serine/threonine-protein kinase N1 (PKN1)
1-CSB-EP623082HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Serine/threonine-protein kinase N1(PKN1),partial expressed in E.coli
Pkn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4951802 1.0 ug DNA
EUR 154
Pkn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4951803 1.0 ug DNA
EUR 154
Pkn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4951804 1.0 ug DNA
EUR 154
Pkn1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6794602 1.0 ug DNA
EUR 154
Pkn1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6794603 1.0 ug DNA
EUR 154
Pkn1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6794604 1.0 ug DNA
EUR 154
Human Protein Kinase N1 (PKN1) ELISA Kit
SEA501Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protein Kinase N1 (PKN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protein Kinase N1 (PKN1) in Tissue homogenates, cell lysates and other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
SEA501Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protein Kinase N1 (PKN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protein Kinase N1 (PKN1) in Tissue homogenates, cell lysates and other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
SEA501Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protein Kinase N1 (PKN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protein Kinase N1 (PKN1) in Tissue homogenates, cell lysates and other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
SEA501Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protein Kinase N1 (PKN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protein Kinase N1 (PKN1) in Tissue homogenates, cell lysates and other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
4-SEA501Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protein Kinase N1 elisa. Alternative names of the recognized antigen: PAK1
  • DBK
  • PRK1
  • PRKCL1
  • Protein Kinase C-Like 1
  • Protein kinase PKN-alpha
  • Protein-kinase C-related kinase 1
  • Serine-threonine protein kinase N
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protein Kinase N1 (PKN1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Protein Kinase N1(PKN1)ELISA Kit
QY-E03860 96T
EUR 361
PKN1 Protein Vector (Human) (pPB-C-His)
PV031521 500 ng
EUR 329
PKN1 Protein Vector (Human) (pPB-N-His)
PV031522 500 ng
EUR 329
PKN1 Protein Vector (Human) (pPM-C-HA)
PV031523 500 ng
EUR 329
PKN1 Protein Vector (Human) (pPM-C-His)
PV031524 500 ng
EUR 329
PKN1 Protein Vector (Mouse) (pPB-C-His)
PV216602 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPB-N-His)
PV216603 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPM-C-HA)
PV216604 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPM-C-His)
PV216605 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPB-C-His)
PV216606 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPB-N-His)
PV216607 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPM-C-HA)
PV216608 500 ng
EUR 1065
PKN1 Protein Vector (Mouse) (pPM-C-His)
PV216609 500 ng
EUR 1065
PKN1 Protein Vector (Rat) (pPB-C-His)
PV294274 500 ng
EUR 1166
PKN1 Protein Vector (Rat) (pPB-N-His)
PV294275 500 ng
EUR 1166
PKN1 Protein Vector (Rat) (pPM-C-HA)
PV294276 500 ng
EUR 1166
PKN1 Protein Vector (Rat) (pPM-C-His)
PV294277 500 ng
EUR 1166
Pkn1 3'UTR GFP Stable Cell Line
TU166449 1.0 ml Ask for price
PKN1 3'UTR Luciferase Stable Cell Line
TU018154 1.0 ml
EUR 1394
Pkn1 3'UTR Luciferase Stable Cell Line
TU116449 1.0 ml Ask for price
PKN1 3'UTR GFP Stable Cell Line
TU068154 1.0 ml
EUR 1394
Pkn1 3'UTR GFP Stable Cell Line
TU266312 1.0 ml Ask for price
Pkn1 3'UTR Luciferase Stable Cell Line
TU216312 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PKN1 Rabbit Polyclonal Antibody