PLD4 Rabbit Polyclonal Antibody

PLD4 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

PLD4 Polyclonal Antibody
ES8933-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLD4 Polyclonal Antibody
ABP59938-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PLD4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLD4 from Human, Mouse, Rat. This PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLD4 protein

PLD4 Polyclonal Antibody
ABP59938-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLD4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLD4 from Human, Mouse, Rat. This PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLD4 protein

PLD4 Polyclonal Antibody
ABP59938-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLD4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLD4 from Human, Mouse, Rat. This PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLD4 protein

PLD4 Polyclonal Antibody
A51089 100 µg
EUR 570.55
Description: fast delivery possible

PLD4 Rabbit pAb
A15207-100ul 100 ul
EUR 308

PLD4 Rabbit pAb
A15207-200ul 200 ul
EUR 459

PLD4 Rabbit pAb
A15207-20ul 20 ul
EUR 183

PLD4 Rabbit pAb
A15207-50ul 50 ul
EUR 223

PC-PLD4 Polyclonal Antibody
ES4701-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PC-PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PC-PLD4 Polyclonal Antibody
ES4701-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PC-PLD4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PC-PLD4 Polyclonal Antibody
ABP53702-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510
  • Applications tips:
Description: A polyclonal antibody for detection of PC-PLD4 from Human, Mouse, Rat. This PC-PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510

PC-PLD4 Polyclonal Antibody
ABP53702-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510
  • Applications tips:
Description: A polyclonal antibody for detection of PC-PLD4 from Human, Mouse, Rat. This PC-PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510

PC-PLD4 Polyclonal Antibody
ABP53702-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510
  • Applications tips:
Description: A polyclonal antibody for detection of PC-PLD4 from Human, Mouse, Rat. This PC-PLD4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PC-PLD4 at AA rangle: 430-510

PLD4 antibody
70R-35616 100 ug
EUR 349
Description: Rabbit polyclonal PLD4 antibody

PLD4 Antibody
ABD4294 100 ug
EUR 438

PLD4 Antibody
34905-100ul 100ul
EUR 252

PLD4 Antibody
34905-50ul 50ul
EUR 187

PLD4 Antibody
DF4294 200ul
EUR 304
Description: PLD4 Antibody detects endogenous levels of total PLD4.

PLD4 Antibody
1-CSB-PA006980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

PLD4 Antibody
1-CSB-PA839298LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

PLD4 Antibody
CSB-PA219574-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PLD4 Antibody
CSB-PA219574-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PLD4 Polyclonal Antibody, HRP Conjugated
A51090 100 µg
EUR 570.55
Description: reagents widely cited

PLD4 Polyclonal Antibody, FITC Conjugated
A51091 100 µg
EUR 570.55
Description: Ask the seller for details

PLD4 Polyclonal Antibody, Biotin Conjugated
A51092 100 µg
EUR 570.55
Description: The best epigenetics products

PLD4 Conjugated Antibody
C34905 100ul
EUR 397

Anti-PLD4 Antibody
A13908 100ul
EUR 397
Description: Rabbit Polyclonal PLD4 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLD4 antibody
STJ99651 200 µl
EUR 197
Description: Rabbit polyclonal to PLD4.

Anti-PLD4 antibody
STJ117401 100 µl
EUR 277

PLD4 siRNA
20-abx928872
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLD4 siRNA
20-abx928873
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PLD4
YF-PA22051 50 ug
EUR 363
Description: Mouse polyclonal to PLD4

Polyclonal PLD4 / Phospholipase D4 Antibody (aa457-506)
AMR09377G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLD4 / Phospholipase D4 (aa457-506). This antibody is tested and proven to work in the following applications:

PLD4 Antibody, HRP conjugated
1-CSB-PA839298LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLD4 Antibody, FITC conjugated
1-CSB-PA839298LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLD4 Antibody, Biotin conjugated
1-CSB-PA839298LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLD4. Recognizes PLD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-PC-PLD4 antibody
STJ94987 200 µl
EUR 197
Description: Rabbit polyclonal to PC-PLD4.

PLD4 Blocking Peptide
DF4294-BP 1mg
EUR 195

PLD4 cloning plasmid
CSB-CL839298HU-10ug 10ug
EUR 521
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1470
  • Sequence: atgccgccccgccgcccgtgggacagagaggctggcacgttgcaggtcctgggagcgctggctgtgctgtggctgggctccgtggctcttatctgcctcctgtggcaagtgccccgtcctcccacctggggccaggtgcagcccaaggacgtgcccaggtcctgggagcatggct
  • Show more
Description: A cloning plasmid for the PLD4 gene.

Mouse PLD4 shRNA Plasmid
20-abx979658
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PLD4 shRNA Plasmid
20-abx964699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Phospholipase D4 (PLD4)
1-CSB-EP839298HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipase D4(PLD4),partial expressed in E.coli

PLD4 Recombinant Protein (Human)
RP023746 100 ug Ask for price

PLD4 Recombinant Protein (Rat)
RP220880 100 ug Ask for price

PLD4 Recombinant Protein (Mouse)
RP162707 100 ug Ask for price

Phospholipase D Family Member 4 (PLD4) Antibody
abx036464-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody
20-abx014716
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody
abx029677-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody
abx029677-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody
20-abx327976
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody
abx332704-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody
20-abx302921
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PLD4 ORF Vector (Human) (pORF)
ORF007916 1.0 ug DNA
EUR 95

Pld4 ORF Vector (Rat) (pORF)
ORF073628 1.0 ug DNA
EUR 506

Pld4 ORF Vector (Mouse) (pORF)
ORF054237 1.0 ug DNA
EUR 506

Phospholipase D Family Member 4 (PLD4) Antibody (HRP)
20-abx309341
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody (FITC)
20-abx309342
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D Family Member 4 (PLD4) Antibody (Biotin)
20-abx309343
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Phospholipase D4, Pld4 ELISA KIT
ELI-19659m 96 Tests
EUR 865

Human Phospholipase D4, PLD4 ELISA KIT
ELI-21616h 96 Tests
EUR 824

Human Phospholipase D4 (PLD4)ELISA Kit
201-12-2644 96 tests
EUR 440
  • This Phospholipase D4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

PLD4 sgRNA CRISPR Lentivector set (Human)
K1664501 3 x 1.0 ug
EUR 339

Pld4 sgRNA CRISPR Lentivector set (Mouse)
K3734001 3 x 1.0 ug
EUR 339

Pld4 sgRNA CRISPR Lentivector set (Rat)
K6349401 3 x 1.0 ug
EUR 339

Human Phospholipase D4(PLD4)ELISA Kit
QY-E02285 96T
EUR 361

PLD4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1664502 1.0 ug DNA
EUR 154

PLD4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1664503 1.0 ug DNA
EUR 154

PLD4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1664504 1.0 ug DNA
EUR 154

Pld4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3734002 1.0 ug DNA
EUR 154

Pld4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3734003 1.0 ug DNA
EUR 154

Pld4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3734004 1.0 ug DNA
EUR 154

Pld4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6349402 1.0 ug DNA
EUR 154

Pld4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6349403 1.0 ug DNA
EUR 154

Pld4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6349404 1.0 ug DNA
EUR 154

PLD4 Protein Vector (Human) (pPB-C-His)
PV031661 500 ng
EUR 329

PLD4 Protein Vector (Human) (pPB-N-His)
PV031662 500 ng
EUR 329

PLD4 Protein Vector (Human) (pPM-C-HA)
PV031663 500 ng
EUR 329

PLD4 Protein Vector (Human) (pPM-C-His)
PV031664 500 ng
EUR 329

PLD4 Protein Vector (Mouse) (pPB-C-His)
PV216946 500 ng
EUR 603

PLD4 Protein Vector (Mouse) (pPB-N-His)
PV216947 500 ng
EUR 603

PLD4 Protein Vector (Mouse) (pPM-C-HA)
PV216948 500 ng
EUR 603

PLD4 Protein Vector (Mouse) (pPM-C-His)
PV216949 500 ng
EUR 603

PLD4 Protein Vector (Rat) (pPB-C-His)
PV294510 500 ng
EUR 603

PLD4 Protein Vector (Rat) (pPB-N-His)
PV294511 500 ng
EUR 603

PLD4 Protein Vector (Rat) (pPM-C-HA)
PV294512 500 ng
EUR 603

PLD4 Protein Vector (Rat) (pPM-C-His)
PV294513 500 ng
EUR 603

Pld4 3'UTR GFP Stable Cell Line
TU166517 1.0 ml Ask for price

PLD4 3'UTR Luciferase Stable Cell Line
TU018226 1.0 ml
EUR 1394

Pld4 3'UTR Luciferase Stable Cell Line
TU116517 1.0 ml Ask for price

PLD4 3'UTR GFP Stable Cell Line
TU068226 1.0 ml
EUR 1394

Pld4 3'UTR GFP Stable Cell Line
TU266377 1.0 ml Ask for price

Pld4 3'UTR Luciferase Stable Cell Line
TU216377 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PLD4 Rabbit Polyclonal Antibody

 

Apex Business WordPress Theme | Designed by Crafthemes