TLR5 Rabbit Polyclonal Antibody

TLR5 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

TLR5 Polyclonal Antibody

ABP60699-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810

TLR5 Polyclonal Antibody

ABP60699-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810

TLR5 Polyclonal Antibody

ES8984-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TLR5 Polyclonal Antibody

ES8984-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Toll Like Receptor 5 (TLR5) ELISA Kit

DLR-TLR5-Hu-48T 48T
EUR 498
  • Should the Human Toll Like Receptor 5 (TLR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 5 (TLR5) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 5 (TLR5) ELISA Kit

DLR-TLR5-Hu-96T 96T
EUR 647
  • Should the Human Toll Like Receptor 5 (TLR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 5 (TLR5) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 5 (TLR5) ELISA Kit

RDR-TLR5-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 5 (TLR5) ELISA Kit

RDR-TLR5-Hu-96Tests 96 Tests
EUR 724

Human Toll Like Receptor 5 (TLR5) ELISA Kit

RD-TLR5-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 5 (TLR5) ELISA Kit

RD-TLR5-Hu-96Tests 96 Tests
EUR 692

TLR5 Rabbit pAb

A1721-100ul 100 ul
EUR 308

TLR5 Rabbit pAb

A1721-200ul 200 ul
EUR 459

TLR5 Rabbit pAb

A1721-20ul 20 ul
EUR 183

TLR5 Rabbit pAb

A1721-50ul 50 ul
EUR 223

Polyclonal TLR5 Antibody (Internal)

APR02281G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (Internal). This antibody is tested and proven to work in the following applications:

Anti-TLR5 Rabbit Monoclonal Antibody

M00462 100ug/vial
EUR 397
Description: Rabbit Monoclonal TLR5 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Polyclonal TLR5 Antibody (C-Terminus)

APR02388G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TLR5 Antibody (aa300-350)

APR02821G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (aa300-350). This antibody is tested and proven to work in the following applications:

TLR5 Antibody

24365-100ul 100ul
EUR 390

TLR5 Antibody

24366-100ul 100ul
EUR 390

TLR5 antibody

20R-1640 100 ug
EUR 673
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody

70R-11906 100 ug
EUR 403
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody

70R-20850 50 ul
EUR 435
Description: Rabbit polyclonal TLR5 antibody

TLR5 Antibody

35397-100ul 100ul
EUR 390

TLR5 Antibody

3555R-100
EUR 316

TLR5 Antibody

3555R-30T
EUR 146

TLR5 Antibody

36165-100ul 100ul
EUR 252

TLR5 antibody

38286-100ul 100ul
EUR 252

TLR5 Antibody

49443-100ul 100ul
EUR 333

TLR5 Antibody

49443-50ul 50ul
EUR 239

TLR5 Antibody

DF6575 200ul
EUR 304
Description: TLR5 Antibody detects endogenous levels of total TLR5.

TLR5 Antibody

1-CSB-PA296982
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR5 Antibody

1-CSB-PA218621
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR5 antibody

70R-5979 50 ug
EUR 467
Description: Rabbit polyclonal TLR5 antibody raised against the N terminal of TLR5

TLR5 Antibody

1-CSB-PA023604GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TLR5 Antibody

CSB-PA023604KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR5 Antibody

CSB-PA023604KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR5 Antibody

1-CSB-PA023604LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TLR5 Antibody

AF7634 200ul
EUR 376
Description: TLR5 Antibody detects endogenous levels of TLR5.

TLR5 Antibody

ABD6575 100 ug
EUR 438

Polyclonal TLR5 antibody - N-terminal region

APR00592G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 - N-terminal region. This antibody is tested and proven to work in the following applications:

TLR5 (Phospho-Tyr798) Polyclonal Conjugated Antibody

C12648 100ul
EUR 397

TLR5 (Phospho-Ser805) Polyclonal Conjugated Antibody

C12997 100ul
EUR 397

TLR5 (pY798) Antibody

abx219007-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

TLR5 Conjugated Antibody

C49443 100ul
EUR 397

TLR5 Conjugated Antibody

C36165 100ul
EUR 397

anti- TLR5 antibody

FNab08728 100µg
EUR 548.75
  • Immunogen: toll-like receptor 5
  • Uniprot ID: O60602
  • Gene ID: 7100
  • Research Area: Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR5

Anti-TLR5 antibody

PAab08728 100 ug
EUR 386

Anti-TLR5 Antibody

PB9451 100ug/vial
EUR 334

Anti-TLR5 antibody

STJ119394 100 µl
EUR 277

Anti-TLR5 antibody

STJ190142 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TLR5

Anti-TLR5 Antibody

STJ503279 100 µg
EUR 476

TLR5(Toll-like receptor 5) Polyclonal Antibody

3555-100
EUR 370

Rabbit Anti-TLR5 monoclonal antibody, clone KN21-99

DCABH-5203 100 ul
EUR 777

TLR5 siRNA

20-abx936897
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR5 siRNA

20-abx936898
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TLR5

YF-PA24857 50 ul
EUR 334
Description: Mouse polyclonal to TLR5

TLR5 (Phospho-Ser805) Antibody

12997-100ul 100ul
EUR 252

TLR5 (Phospho-Ser805) Antibody

12997-50ul 50ul
EUR 187

TLR5 (Phospho-Tyr798) Antibody

12648-100ul 100ul
EUR 252

TLR5 (Phospho-Tyr798) Antibody

12648-50ul 50ul
EUR 187

Phospho-TLR5 (Ser805) Antibody

AF7134 200ul
EUR 376
Description: Phospho-TLR5 (Ser805) Antibody detects endogenous levels of TLR5 only when phosphorylated at Ser805.

TLR5 Antibody, HRP conjugated

1-CSB-PA023604LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLR5 Antibody, FITC conjugated

1-CSB-PA023604LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLR5 Antibody, Biotin conjugated

1-CSB-PA023604LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-TLR5 (Tyr798) Antibody

AF8327 200ul
EUR 376
Description: TLR5 (Phospho-Tyr798) Antibody detects endogenous levels of TLR5 only when phosphorylated at Tyr798.

TLR5 (Phospho- Tyr798) Antibody

ABF8327 100 ug
EUR 438

TLR5 recombinant monoclonal antibody

A5022 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TLR5 for WB,ELISA

Anti-TLR5 Antibody (Biotin)

STJ503301 100 µg
EUR 586

Anti-TLR5 Antibody (FITC)

STJ503302 100 µg
EUR 586

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human)

4-PAB990Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human)

4-PAB990Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human)

4-PAB990Hu03
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse)

4-PAB990Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat)

4-PAB990Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5)

TLR5 Blocking Peptide

33R-10801 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR5 antibody, catalog no. 70R-11906

TLR5 Blocking Peptide

3555RBP-50
EUR 153

TLR5 Blocking Peptide

33R-7642 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR5 antibody, catalog no. 70R-5979

TLR5 Blocking Peptide

DF6575-BP 1mg
EUR 195

TLR5 cloning plasmid

CSB-CL023604HU-10ug 10ug
EUR 831
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2577
  • Sequence: ATGGGAGACCACCTGGACCTTCTCCTAGGAGTGGTGCTCATGGCCGGTCCTGTGTTTGGAATTCCTTCCTGCTCCTTTGATGGCCGAATAGCCTTTTATCGTTTCTGCAACCTCACCCAGGTCCCCCAGGTCCTCAACACCACTGAGAGGCTCCTGCTGAGCTTCAACTATATCA
  • Show more
Description: A cloning plasmid for the TLR5 gene.

TLR5 Blocking Peptide

AF7634-BP 1mg
EUR 195

Recombinant human TLR5

P2063 100ug Ask for price
  • Uniprot ID: O60602
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human TLR5

Anti-TLR5 (4F7)

YF-MA15896 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (3E4)

YF-MA15897 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (4B2)

YF-MA15898 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (4G5)

YF-MA15899 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (3H6)

YF-MA15900 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (1A11)

YF-MA15901 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (1E1)

YF-MA15902 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (4D12)

YF-MA15903 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (3A2)

YF-MA15904 100 ug
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (4G5)

YF-MA20224 200 ul
EUR 363
Description: Mouse monoclonal to TLR5

Anti-TLR5 (1E1)

YF-MA20440 200 ul
EUR 363
Description: Mouse monoclonal to TLR5

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), APC

4-PAB990Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with APC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), Biotinylated

4-PAB990Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with Biotin.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), Cy3

4-PAB990Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with Cy3.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), FITC

4-PAB990Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with FITC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), HRP

4-PAB990Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with HRP.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), PE

4-PAB990Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with PE.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), APC

4-PAB990Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with APC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), Biotinylated

4-PAB990Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with Biotin.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), Cy3

4-PAB990Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with Cy3.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), FITC

4-PAB990Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with FITC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), HRP

4-PAB990Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with HRP.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), PE

4-PAB990Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with PE.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), APC

4-PAB990Hu03-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with APC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), Biotinylated

4-PAB990Hu03-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with Biotin.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), Cy3

4-PAB990Hu03-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with Cy3.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), FITC

4-PAB990Hu03-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with FITC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), HRP

4-PAB990Hu03-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with HRP.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), PE

4-PAB990Hu03-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with PE.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), APC

4-PAB990Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with APC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), Biotinylated

4-PAB990Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with Biotin.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), Cy3

4-PAB990Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with Cy3.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), FITC

4-PAB990Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with FITC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), HRP

4-PAB990Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with HRP.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), PE

4-PAB990Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with PE.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), APC

4-PAB990Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with APC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), Biotinylated

4-PAB990Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with Biotin.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), Cy3

4-PAB990Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with Cy3.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), FITC

4-PAB990Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with FITC.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), HRP

4-PAB990Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with HRP.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), PE

4-PAB990Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with PE.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), APC-Cy7

4-PAB990Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with APC-Cy7.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), APC-Cy7

4-PAB990Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with APC-Cy7.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human), APC-Cy7

4-PAB990Hu03-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5). This antibody is labeled with APC-Cy7.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB990Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5). This antibody is labeled with APC-Cy7.

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat), APC-Cy7

4-PAB990Ra01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5). This antibody is labeled with APC-Cy7.

Toll Like Receptor 5 (TLR5) Antibody

20-abx102070
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx102071
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx102072
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx102073
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 5 (TLR5) Antibody

20-abx116125
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll-Like Receptor 5 (TLR5) Antibody

abx117144-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx130822
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx130823
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx131784
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 5 (TLR5) Antibody

abx122852-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx270110
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll-Like Receptor 5 (TLR5) Antibody

abx238728-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx339870
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 5 (TLR5) Antibody

20-abx339871
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll-Like Receptor 5 (TLR5) Antibody

20-abx318233
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human TLR5 ELISA Kit

ELA-E1990h 96 Tests
EUR 824

TLR5 ELISA KIT|Human

EF006126 96 Tests
EUR 689

Mouse TLR5 shRNA Plasmid

20-abx974373
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TLR5 shRNA Plasmid

20-abx954867
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-Flag-TLR5 Plasmid

PVTB00526-2a 2 ug
EUR 356

pEYFP-N1-TLR5 Plasmid

PVTB00526-2b 2 ug
EUR 356

pEGFP-N1-TLR5 Plasmid

PVTB00526-2c 2 ug
EUR 356

Toll Like Receptor 5 (TLR5) Antibody (FITC)

20-abx270408
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 5 (TLR5) Antibody (APC)

20-abx270640
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 5 (TLR5) Antibody (PE)

20-abx270872
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 5 (TLR5) Antibody (Biotin)

20-abx272230
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll-Like Receptor 5 (TLR5) Antibody (HRP)

20-abx315347
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 5 (TLR5) Antibody (FITC)

20-abx315348
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 5 (TLR5) Antibody (Biotin)

20-abx315349
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll Like Receptor 5 (TLR5) Antibody Pair

20-abx370288
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-12 working days.

Toll Like Receptor 5 (TLR5) Antibody (FITC)

20-abx273660
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll Like Receptor 5 (TLR5) Antibody (Biotin)

20-abx274462
  • EUR 606.00
  • EUR 286.00
  • EUR 1901.00
  • EUR 857.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Monoclonal TLR5 Antibody (monoclonal) (M03), Clone: 4B2

AMM04205G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TLR5 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B2. This antibody is applicable in E

Monoclonal TLR5 Antibody (monoclonal) (M07), Clone: 10

AMM04206G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TLR5 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 10. This antibody is applicable in E

Phospho-TLR5 (Ser805) Blocking Peptide

AF7134-BP 1mg
EUR 195

Phospho-TLR5 (Tyr798) Blocking Peptide

AF8327-BP 1mg
EUR 195

Tlr5 ORF Vector (Rat) (pORF)

ORF077759 1.0 ug DNA
EUR 506

h TLR5 inducible lentiviral particles

LVP747 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h TLR5 (toll-like receptor 5), [alternative names: MELIOS; SLEB1; TIL3]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003268. It also contains a RFP-Blasticidin dual selection marker.

TLR5 ORF Vector (Human) (pORF)

ORF014728 1.0 ug DNA
EUR 405

Tlr5 ORF Vector (Mouse) (pORF)

ORF059658 1.0 ug DNA
EUR 506

TLR5 ELISA Kit (Human) (OKCD01244)

OKCD01244 96 Wells
EUR 792
Description: Description of target: Participates in the innate immune response to microbial agents. Mediates detection of bacterial flagellins. Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5."_x005F_x005F_x000D_Hayashi F., Smith K.D., Ozinsky A., Hawn T.R., Yi E.C., Goodlett D.R., Eng J.K., Akira S., Underhill D.M., Aderem A._x005F_x005F_x000D_Nature 410:1099-1103(2001) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.32 ng/mL

TLR5 ELISA Kit (Mouse) (OKCA02466)

OKCA02466 96 Wells
EUR 970
Description: Description of target: Participates in the innate immune response to microbial agents. Mediates detection of bacterial flagellins. Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 19.5 pg/mL

Toll Like Receptor 5 (TLR5) Monoclonal Antibody (Human)

4-MAB990Hu21
  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Tyr693~Ser858
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Monoclonal Antibody (Human)

4-MAB990Hu22
  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Tyr693~Ser858
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 5 (TLR5)

Tlr5 sgRNA CRISPR Lentivector set (Rat)

K6714301 3 x 1.0 ug
EUR 339

Tlr5 sgRNA CRISPR Lentivector set (Mouse)

K4372601 3 x 1.0 ug
EUR 339

TLR5 sgRNA CRISPR Lentivector set (Human)

K2380001 3 x 1.0 ug
EUR 339

Recombinant Toll Like Receptor 5 (TLR5)

4-RPB990Hu01
  • EUR 297.12
  • EUR 182.00
  • EUR 839.20
  • EUR 346.40
  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60602
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 5 expressed in: E.coli

Recombinant Toll Like Receptor 5 (TLR5)

4-RPB990Hu02
  • EUR 297.12
  • EUR 182.00
  • EUR 839.20
  • EUR 346.40
  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60602
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.4kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Toll Like Receptor 5 expressed in: E.coli

Recombinant Toll Like Receptor 5 (TLR5)

4-RPB990Hu03
  • EUR 297.12
  • EUR 182.00
  • EUR 839.20
  • EUR 346.40
  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60602
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 5 expressed in: E.coli

Recombinant Toll Like Receptor 5 (TLR5)

4-RPB990Mu01
  • EUR 324.00
  • EUR 190.00
  • EUR 940.00
  • EUR 380.00
  • EUR 660.00
  • EUR 280.00
  • EUR 2200.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JLF7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Toll Like Receptor 5 expressed in: E.coli

TLR5 Rabbit Polyclonal Antibody