AP2M1 Rabbit Polyclonal Antibody

AP2M1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

AP2M1 Polyclonal Antibody

A54500 100 µg
EUR 570.55
Description: The best epigenetics products

AP2M1 Polyclonal Antibody

ABP57785-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180

AP2M1 Polyclonal Antibody

ABP57785-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180

AP2M1 Polyclonal Antibody

ABP57785-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180

AP2M1 Polyclonal Antibody

ES8998-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AP2M1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AP2M1 Polyclonal Antibody

ES8998-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AP2M1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AP2M1 Rabbit mAb

A11070-100ul 100 ul
EUR 410

AP2M1 Rabbit mAb

A11070-200ul 200 ul
EUR 571

AP2M1 Rabbit mAb

A11070-20ul 20 ul
EUR 221

AP2M1 Rabbit mAb

A11070-50ul 50 ul
EUR 287

AP2M1 Rabbit pAb

A13962-100ul 100 ul
EUR 308

AP2M1 Rabbit pAb

A13962-200ul 200 ul
EUR 459

AP2M1 Rabbit pAb

A13962-20ul 20 ul
EUR 183

AP2M1 Rabbit pAb

A13962-50ul 50 ul
EUR 223

AP2M1 Rabbit pAb

A2492-100ul 100 ul
EUR 308

AP2M1 Rabbit pAb

A2492-200ul 200 ul
EUR 459

AP2M1 Rabbit pAb

A2492-20ul 20 ul
EUR 183

AP2M1 Rabbit pAb

A2492-50ul 50 ul
EUR 223

AP2M1 Polyclonal Antibody, HRP Conjugated

A53866 100 µg
EUR 570.55
Description: The best epigenetics products

AP2M1 Polyclonal Antibody, FITC Conjugated

A53867 100 µg
EUR 570.55
Description: kits suitable for this type of research

AP2M1 Polyclonal Antibody, Biotin Conjugated

A53868 100 µg
EUR 570.55
Description: fast delivery possible

AP2M1 Polyclonal Antibody, HRP Conjugated

A54501 100 µg
EUR 570.55
Description: kits suitable for this type of research

AP2M1 Polyclonal Antibody, FITC Conjugated

A54502 100 µg
EUR 570.55
Description: fast delivery possible

AP2M1 Polyclonal Antibody, Biotin Conjugated

A54503 100 µg
EUR 570.55
Description: reagents widely cited

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

DLR-AP2m1-Hu-48T 48T
EUR 517
  • Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids.

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

DLR-AP2m1-Hu-96T 96T
EUR 673
  • Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids.

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RDR-AP2m1-Hu-48Tests 48 Tests
EUR 544

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RDR-AP2m1-Hu-96Tests 96 Tests
EUR 756

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RD-AP2m1-Hu-48Tests 48 Tests
EUR 521

Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit

RD-AP2m1-Hu-96Tests 96 Tests
EUR 723

AP2M1 Antibody

24892-100ul 100ul
EUR 390

AP2M1 antibody

70R-12583 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal AP2M1 antibody

AP2M1 antibody

70R-15215 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody

AP2M1 Antibody

32670-100ul 100ul
EUR 252

AP2M1 antibody

10R-3324 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 antibody

10R-3326 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 antibody

10R-3327 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 antibody

10R-3331 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody

AP2M1 Antibody

49143-100ul 100ul
EUR 333

AP2M1 Antibody

49143-50ul 50ul
EUR 239

AP2M1 Antibody

1-CSB-PA850274ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AP2M1 Antibody

1-CSB-PA00625A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

AP2M1 Antibody

1-CSB-PA00627A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

AP2M1 Antibody

DF6961 200ul
EUR 304
Description: AP2M1 Antibody detects endogenous levels of total AP2M1.

AP2M1 Antibody

1-CSB-PA227771
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

AP2M1 Antibody

1-CSB-PA248529
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

AP2M1 antibody

70R-36178 100 ug
EUR 349
Description: Rabbit polyclonal AP2M1 antibody

AP2M1 antibody

70R-49558 100 ul
EUR 244
Description: Purified Polyclonal AP2M1 antibody

AP2M1 Antibody

ABD6961 100 ug
EUR 438

Phospho-AP2M1-T156 Rabbit pAb

AP0823-100ul 100 ul
EUR 384

Phospho-AP2M1-T156 Rabbit pAb

AP0823-200ul 200 ul
EUR 554

Phospho-AP2M1-T156 Rabbit pAb

AP0823-20ul 20 ul
EUR 183

Phospho-AP2M1-T156 Rabbit pAb

AP0823-50ul 50 ul
EUR 265

Anti-AP2M1 Antibody

A06179 100ug/vial
EUR 294

AP2M1 antibody (HRP)

60R-1485 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (HRP)

AP2M1 antibody (FITC)

60R-1486 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (FITC)

AP2M1 antibody (biotin)

60R-1487 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (biotin)

AP2M1 Conjugated Antibody

C49143 100ul
EUR 397

AP2M1 Conjugated Antibody

C32670 100ul
EUR 397

Anti-AP2M1 antibody

STJ115897 100 µl
EUR 277
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.

Anti-AP2M1 antibody

STJ22628 100 µl
EUR 277
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.

Anti-AP2M1 antibody

STJ190156 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AP2M1

Rabbit Anti-AP2M1 monoclonal antibody, clone TE0857

DCABH-9663 100 ul
EUR 777

Ap2m1/ Rat Ap2m1 ELISA Kit

ELI-24339r 96 Tests
EUR 886

AP2M1 siRNA

20-abx900351
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP2M1 siRNA

20-abx907722
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP2M1 siRNA

20-abx907723
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP2M1 Antibody, HRP conjugated

1-CSB-PA00625B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AP2M1 Antibody, FITC conjugated

1-CSB-PA00625C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AP2M1 Antibody, Biotin conjugated

1-CSB-PA00625D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AP2M1 Antibody, HRP conjugated

1-CSB-PA00627B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AP2M1 Antibody, FITC conjugated

1-CSB-PA00627C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AP2M1 Antibody, Biotin conjugated

1-CSB-PA00627D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AP2M1/Ap 2 Mu 1 Rabbit Monoclonal Antibody

M06179 100ug/vial
EUR 397
Description: Rabbit Monoclonal AP2M1/Ap 2 Mu 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

AP2M1 Blocking Peptide

DF6961-BP 1mg
EUR 195

AP2M1 Blocking Peptide

20-abx062433
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AP2M1 cloning plasmid

CSB-CL850274HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
  • Show more
Description: A cloning plasmid for the AP2M1 gene.

AP2M1 cloning plasmid

CSB-CL850274HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
  • Show more
Description: A cloning plasmid for the AP2M1 gene.

pDONR223-AP2M1 Plasmid

PVTB01145-1 2 ug
EUR 356

pENTR223-AP2M1 vector

PVT12121 2 ug
EUR 308

Anti-Phospho-AP2M1-(T156) antibody

STJ117921 100 µl
EUR 393
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.

Rat AP2M1 shRNA Plasmid

20-abx987281
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AP2M1 shRNA Plasmid

20-abx969166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AP2M1 shRNA Plasmid

20-abx950836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-AP2M1

PVT12642 2 ug
EUR 703

AP2M1 Recombinant Protein (Human)

RP001444 100 ug Ask for price

AP2M1 Recombinant Protein (Human)

RP001447 100 ug Ask for price

AP2M1 Recombinant Protein (Mouse)

RP116252 100 ug Ask for price

AP2M1 Recombinant Protein (Rat)

RP190430 100 ug Ask for price

Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit

E04A1073-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit

E04A1073-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit

E04A1073-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP-2 complex subunit mu(AP2M1) ELISA kit

E04A1565-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AP-2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP-2 complex subunit mu(AP2M1) ELISA kit

E04A1565-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AP-2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP-2 complex subunit mu(AP2M1) ELISA kit

E04A1565-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AP-2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human)

4-PAG107Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1)

AP-2 Complex Subunit Mu (AP2M1) Antibody

20-abx009429
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

AP-2 Complex Subunit Mu (AP2M1) Antibody

abx036432-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

AP-2 Complex Subunit Mu (AP2M1) Antibody

20-abx320133
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

AP-2 Complex Subunit Mu (AP2M1) Antibody

20-abx001936
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ap2m1 ORF Vector (Rat) (pORF)

ORF063478 1.0 ug DNA
EUR 506

AP2M1 ORF Vector (Human) (pORF)

ORF000482 1.0 ug DNA
EUR 95

AP2M1 ORF Vector (Human) (pORF)

ORF000483 1.0 ug DNA
EUR 95

Ap2m1 ORF Vector (Mouse) (pORF)

ORF038752 1.0 ug DNA
EUR 506

AP2M1 ELISA Kit (Human) (OKCD00488)

OKCD00488 96 Wells
EUR 831
Description: Description of target: Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin-coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. The AP-2 mu subunit binds to transmembrane cargo proteins; it recognizes the Y-X-X-Phi motifs. The surface region interacting with to the Y-X-X-Phi motif is inaccessible in cytosolic AP-2, but becomes accessible through a conformational change following phosphorylation of AP-2 mu subunit at 'Tyr-156' in membrane-associated AP-2. The membrane-specific phosphorylation event appears to involve assembled clathrin which activates the AP-2 mu kinase AAK1 (By similarity). Plays a role in endocytosis of frizzled family members upon Wnt signaling (By similarity).By similarity7 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Adaptor protein complexes as the key regulators of protein sorting in the post-Golgi network."_x005F_x005F_x000D_Nakatsu F., Ohno H._x005F_x005F_x000D_Cell Struct. Funct. 28:419-429(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION OF THE AP-2 COMPLEX IN CLATHRIN-MEDIATED ENDOCYTOSIS.Ref.9"Clathrin-mediated endocytosis in AP-2-depleted cells."_x005F_x005F_x000D_Motley A., Bright N.A., Seaman M.N.J., Robinson M.S._x005F_x005F_x000D_J. Cell Biol. 162:909-918(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CLATHRIN-MEDIATED ENDOCYTOSIS.Ref.10"Endocytosis of the viral chemokine receptor US28 does not require beta-arrestins but is dependent on the clathrin-mediated pathway."_x005F_x005F_x000D_Fraile-Ramos A., Kohout T.A., Waldhoer M., Marsh M._x005F_x005F_x000D_Traffic 4:243-253(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CLATHRIN-MEDIATED ENDOCYTOSIS.Ref.11"Adaptors for clathrin coats: structure and function."_x005F_x005F_x000D_Owen D.J., Collins B.M., Evans P.R._x005F_x005F_x000D_Annu. Rev. Cell Dev. Biol. 20:153-191(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION OF THE AP-2 COMPLEX IN CLATHRIN-MEDIATED ENDOCYTOSIS.Ref.12"Analysis of clathrin-mediated endocytosis of epidermal growth factor receptor by RNA interference."_x005F_x005F_x000D_Huang F., Khvorova A., Marshall W., Sorkin A._x005F_x005F_x000D_J. Biol. Chem. 279:16657-16661(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN CLATHRIN-MEDIATED ENDOCYTOSIS.Ref.13"Clathrin adaptor AP2 regulates thrombin receptor constitutive internalization and endothelial cell resensitization."_x005F_x005F_x000D_Paing M.M., Johnston C.A., Siderovski D.P., Trejo J._x005F_x005F_x000D_Mol. Cell. Biol. 26:3231-3242(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN RECEPTOR INTERNALIZATION, INTERACTION WITH F2R.Ref.15"The adaptor complex AP-2 regulates post-endocytic trafficking through the non-clathrin Arf6-dependent endocytic pathway."_x005F_x005F_x000D_Lau A.W., Chou M.M._x005F_x005F_x000D_J. Cell Sci. 121:4008-4017(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION OF THE AP-2 COMPLEX IN NON-CLATHRIN-DEPENDENT ENDOCYTOSIS. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL

AP2m1 ELISA Kit (Human) (OKDD00126)

OKDD00126 96 Wells
EUR 975
Description: Description of target: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), APC

4-PAG107Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with APC.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), Biotinylated

4-PAG107Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with Biotin.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), Cy3

4-PAG107Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with Cy3.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), FITC

4-PAG107Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with FITC.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), HRP

4-PAG107Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with HRP.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), PE

4-PAG107Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with PE.

AP-2 Complex Subunit Mu (AP2M1) Antibody Pair

abx117444-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Polyclonal Antibody (Human), APC-Cy7

4-PAG107Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AP2m1 (Arg170~Cys435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1). This antibody is labeled with APC-Cy7.

Ap2m1 sgRNA CRISPR Lentivector set (Mouse)

K4949601 3 x 1.0 ug
EUR 339

Ap2m1 sgRNA CRISPR Lentivector set (Rat)

K7043901 3 x 1.0 ug
EUR 339

AP2M1 sgRNA CRISPR Lentivector set (Human)

K0100701 3 x 1.0 ug
EUR 339

Adaptor Related Protein Complex 2 Mu 1 (AP2M1) Antibody

20-abx213702
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Antibody

20-abx129244
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adaptor Related Protein Complex 2 Mu 1 (AP2M1) Antibody

20-abx109546
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adaptor Related Protein Complex 2 Mu 1 (AP2M1) Antibody

20-abx109547
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adaptor Related Protein Complex 2 Mu 1 (AP2m1) Antibody

20-abx171074
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adaptor Related Protein Complex 2 Mu 1 (AP2M1) Antibody

20-abx241191
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

AP2M1 Rabbit Polyclonal Antibody