NDRG1 Rabbit Polyclonal Antibody

NDRG1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

Polyclonal NDRG1 Antibody
APR00120G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDRG1 . This antibody is tested and proven to work in the following applications:

NDRG1 Polyclonal Antibody
ABP59419-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350 Applications tips:
Description: A polyclonal antibody for detection of NDRG1 from Human, Mouse, Rat. This NDRG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350

NDRG1 Polyclonal Antibody
ABP59419-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350 Applications tips:
Description: A polyclonal antibody for detection of NDRG1 from Human, Mouse, Rat. This NDRG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350

NDRG1 Polyclonal Antibody
ABP59419-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350 Applications tips:
Description: A polyclonal antibody for detection of NDRG1 from Human, Mouse, Rat. This NDRG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350

NDRG1 Polyclonal Antibody
ES9005-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NDRG1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NDRG1 Polyclonal Antibody
ES9005-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NDRG1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NDRG1 Rabbit mAb
A4050-100ul	Abclonal	100 ul	EUR 410

NDRG1 Rabbit mAb
A4050-200ul	Abclonal	200 ul	EUR 571

NDRG1 Rabbit mAb
A4050-20ul	Abclonal	20 ul	EUR 221

NDRG1 Rabbit mAb
A4050-50ul	Abclonal	50 ul	EUR 287

NDRG1 Rabbit pAb
A2142-100ul	Abclonal	100 ul	EUR 308

NDRG1 Rabbit pAb
A2142-200ul	Abclonal	200 ul	EUR 459

NDRG1 Rabbit pAb
A2142-20ul	Abclonal	20 ul	EUR 183

NDRG1 Rabbit pAb
A2142-50ul	Abclonal	50 ul	EUR 223

NDRG1 Polyclonal Conjugated Antibody
C30281	SAB	100ul	EUR 397

Protein NDRG1 (NDRG1) Antibody
abx117224-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody
abx122680-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody
20-abx142091	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody
abx033076-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody
abx033076-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody
20-abx242227	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody
abx431448-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Protein NDRG1 (NDRG1) Antibody
20-abx001754	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protein NDRG1 (NDRG1) Antibody (Biotin)
abx431449-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

NDRG1 antibody
70R-1121	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NDRG1 antibody raised against the N terminal of NDRG1

NDRG1 antibody
70R-1123	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NDRG1 antibody raised against the C terminal of NDRG1

NDRG1 antibody
70R-13957	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal NDRG1 antibody

NDRG1 Antibody
3526-100	Biovision		EUR 349

NDRG1 Antibody
3526-30T	Biovision		EUR 146

NDRG1 Antibody
32622-100ul	SAB	100ul	EUR 252

NDRG1 Antibody
49614-100ul	SAB	100ul	EUR 333

NDRG1 Antibody
49614-50ul	SAB	50ul	EUR 239

NDRG1 Antibody
DF6865	Affbiotech	200ul	EUR 304
Description: NDRG1 Antibody detects endogenous levels of total NDRG1.

NDRG1 Antibody
CSB-PA015610KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NDRG1. Recognizes NDRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NDRG1 Antibody
CSB-PA015610KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NDRG1. Recognizes NDRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NDRG1 Antibody
1-CSB-PA189423	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NDRG1. Recognizes NDRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NDRG1 Antibody
ABD6865	Lifescience Market	100 ug	EUR 438

[KO Validated] NDRG1 Polyclonal Antibody
30281-100ul	SAB	100ul	EUR 252

[KO Validated] NDRG1 Polyclonal Antibody
30281-50ul	SAB	50ul	EUR 187

Polyclonal NDRG1 Antibody (N-term)
APR05823G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDRG1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-NDRG1 Antibody
APG00213G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NDRG1 . This antibody is tested and proven to work in the following applications:

Polyclonal NDRG1 Antibody (C-Terminus)
APG01076G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDRG1 (C-Terminus). This antibody is tested and proven to work in the following applications:

NDRG1 (Phospho-Thr346) Polyclonal Conjugated Antibody
C12767	SAB	100ul	EUR 397

Phospho-NDRG1-T346 Rabbit pAb
AP0792-100ul	Abclonal	100 ul	EUR 384

Phospho-NDRG1-T346 Rabbit pAb
AP0792-200ul	Abclonal	200 ul	EUR 554

Phospho-NDRG1-T346 Rabbit pAb
AP0792-20ul	Abclonal	20 ul	EUR 183

Phospho-NDRG1-T346 Rabbit pAb
AP0792-50ul	Abclonal	50 ul	EUR 265

Phospho-NDRG1-S330 Rabbit pAb
AP0807-100ul	Abclonal	100 ul	EUR 384

Phospho-NDRG1-S330 Rabbit pAb
AP0807-200ul	Abclonal	200 ul	EUR 554

Phospho-NDRG1-S330 Rabbit pAb
AP0807-20ul	Abclonal	20 ul	EUR 183

Phospho-NDRG1-S330 Rabbit pAb
AP0807-50ul	Abclonal	50 ul	EUR 265

[KO Validated] NDRG1 Rabbit pAb
A18057-100ul	Abclonal	100 ul	EUR 410

[KO Validated] NDRG1 Rabbit pAb
A18057-200ul	Abclonal	200 ul	EUR 571

[KO Validated] NDRG1 Rabbit pAb
A18057-20ul	Abclonal	20 ul	EUR 221

[KO Validated] NDRG1 Rabbit pAb
A18057-50ul	Abclonal	50 ul	EUR 287

Anti-NDRG1 Antibody
A01327-1	BosterBio	100ug/vial	EUR 294

NDRG1 (pS330) Antibody
abx217081-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

NDRG1 (pT346) Antibody
abx217082-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

NDRG1 Conjugated Antibody
C49614	SAB	100ul	EUR 397

NDRG1 Conjugated Antibody
C32622	SAB	100ul	EUR 397

Anti-NDRG1 Antibody
PA1416	BosterBio	100ug/vial	EUR 334

Anti-NDRG1 antibody
STJ11100030	St John's Laboratory	100 µl	EUR 413
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-NDRG1 antibody
STJ24711	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-NDRG1 antibody
STJ190163	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NDRG1

Anti-NDRG1 antibody
STJ70275	St John's Laboratory	100 µg	EUR 359

Ndrg1/ Rat Ndrg1 ELISA Kit
ELI-22197r	Lifescience Market	96 Tests	EUR 886

Anti-NDRG1 Antibody Clone NDRG1/1383, Unconjugated-20ug
10397-MSM1-P0	EnQuireBio	20ug	EUR 233

Anti-NDRG1 Antibody Clone NDRG1/1383, Unconjugated-100ug
10397-MSM1-P1	EnQuireBio	100ug	EUR 428

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNUM1383-50	Biotium	50uL	EUR 395
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383), 1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNUB1383-100	Biotium	100uL	EUR 209
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383), Concentration: 0.2mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNUB1383-500	Biotium	500uL	EUR 458
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383), Concentration: 0.2mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC551383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF555 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC551383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF555 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC611383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF660R conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC611383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF660R conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC471383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF647 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC471383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF647 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC051383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405M conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC051383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405M conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC401383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF640R conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC401383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF640R conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC431383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF543 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC431383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF543 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC041383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405S conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC041383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405S conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC701383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF770 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC701383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF770 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC801383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC801383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCH1383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCH1383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCP1383-250	Biotium	250uL	EUR 383
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),PerCP conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCR1383-250	Biotium	250uL	EUR 383
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),RPE conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCA1383-250	Biotium	250uL	EUR 383
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),APC conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCB1383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Biotin conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCB1383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Biotin conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC881383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF488A conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC881383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF488A conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC941383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF594 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC941383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF594 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC681383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF568 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC681383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF568 conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCAP1383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCAP1383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC811383-100	Biotium	100uL	EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680R conjugate, Concentration: 0.1mg/mL

NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC811383-500	Biotium	500uL	EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680R conjugate, Concentration: 0.1mg/mL

Human Protein NDRG1 (NDRG1) ELISA Kit
abx250909-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Ndrg1/ Protein NDRG1 ELISA Kit
E1662Mo	Sunlong	1 Kit	EUR 632

Human NDRG1/ Protein NDRG1 ELISA Kit
E1719Hu	Sunlong	1 Kit	EUR 605

Human NDRG1(Protein NDRG1) ELISA Kit
EH1617	FN Test	96T	EUR 567.6
Detection range: 0.625-40 ng/ml Uniprot ID: Q92597 Alias: NDRG1/Protein NDRG1/Rit42/Reducing agents and tunicamycin-responsive protein/RTP/Nickel-specific induction protein Cap43/Differentiation-related gene 1 protein/DRG-1/N-myc downstream-regulated Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Mouse Protein NDRG1, Ndrg1 ELISA KIT
ELI-16438m	Lifescience Market	96 Tests	EUR 865

Bovine Protein NDRG1, NDRG1 ELISA KIT
ELI-20679b	Lifescience Market	96 Tests	EUR 928

Human Protein NDRG1, NDRG1 ELISA KIT
ELI-20680h	Lifescience Market	96 Tests	EUR 824

Cow Protein NDRG1 (NDRG1) ELISA Kit
abx516974-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protein NDRG1 (NDRG1) ELISA Kit
abx516976-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Protein NDRG1 (NDRG1) ELISA Kit
abx516977-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

NDRG1 siRNA
20-abx903500	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NDRG1 siRNA
20-abx925564	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NDRG1 siRNA
20-abx925565	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NDRG1
YF-PA16929	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to NDRG1

anti-NDRG1
YF-PA27472	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NDRG1

anti-NDRG1
YF-PA25566	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to NDRG1

NDRG1 (Phospho-Thr346) Antibody
12767-100ul	SAB	100ul	EUR 252

NDRG1 (Phospho-Thr346) Antibody
12767-50ul	SAB	50ul	EUR 187

Phospho-NDRG1 (Ser330) Antibody
AF8493	Affbiotech	200ul	EUR 376
Description: NDRG1 (Phospho-Ser330) Antibody detects endogenous levels of NDRG1 only when phosphorylated at Ser330.

Phospho-NDRG1 (Thr346) Antibody
AF8494	Affbiotech	200ul	EUR 376
Description: NDRG1 (Phospho-Thr346) Antibody detects endogenous levels of NDRG1 only when phosphorylated at Thr346.

NDRG1 (Phospho- Ser330) Antibody
ABF8493	Lifescience Market	100 ug	EUR 438

NDRG1 (Phospho- Thr346) Antibody
ABF8494	Lifescience Market	100 ug	EUR 438

Anti-NDRG1 Monoclonal Antibody
M01327-1	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal NDRG1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-NDRG1, Biotinylated antibody
STJ73261	St John's Laboratory	100 µg	EUR 359

Ndrg1 ELISA Kit| Rat Protein NDRG1 ELISA Kit
EF019081	Lifescience Market	96 Tests	EUR 689

Ndrg1 ELISA Kit| Mouse Protein NDRG1 ELISA Kit
EF015705	Lifescience Market	96 Tests	EUR 689

NDRG1 ELISA Kit| Bovine Protein NDRG1 ELISA Kit
EF011673	Lifescience Market	96 Tests	EUR 689

NDRG1 Blocking Peptide
33R-3588	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NDRG1 antibody, catalog no. 70R-1123

NDRG1 Blocking Peptide
3526BP-50	Biovision		EUR 153

NDRG1 Blocking Peptide
33R-6485	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NDRG1 antibody, catalog no. 70R-1121

Human Recombinant NDRG1
6391-100	Biovision		EUR 370

NDRG1 Blocking Peptide
DF6865-BP	Affbiotech	1mg	EUR 195

NDRG1 cloning plasmid
CSB-CL835678HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1185 Sequence: atgtctcgggagatgcaggatgtagacctcgctgaggtgaagcctttggtggagaaaggggagaccatcaccggcctcctgcaagagtttgatgtccaggagcaggacatcgagactttacatggctctgttcacgtcacgctgtgtgggactcccaagggaaaccggcctgtca Show more
Description: A cloning plasmid for the NDRG1 gene.

NDRG1 cloning plasmid
CSB-CL835678HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 330 Sequence: atggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctc Show more
Description: A cloning plasmid for the NDRG1 gene.

Anti-NDRG1 (2D7)
YF-MA11279	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NDRG1

Anti-Phospho-NDRG1-(T346) antibody
STJ117890	St John's Laboratory	100 µl	EUR 393
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-Phospho-NDRG1-(S330) antibody
STJ117905	St John's Laboratory	100 µl	EUR 393
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

NDRG1 protein (His tag)
80R-1193	Fitzgerald	100 ug	EUR 224
Description: Purified recombinant Human NDRG1 protein

Human NDRG1 ELISA Kit
ELA-E14498h	Lifescience Market	96 Tests	EUR 824

NDRG1 ELISA KIT|Human
EF005769	Lifescience Market	96 Tests	EUR 689

Rat NDRG1 shRNA Plasmid
20-abx989014	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NDRG1 shRNA Plasmid
20-abx971699	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NDRG1 shRNA Plasmid
20-abx957046	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NDRG1 Recombinant Protein (Human)
RP020902	ABM	100 ug	Ask for price

NDRG1 Recombinant Protein (Mouse)
RP153401	ABM	100 ug	Ask for price

NDRG1 Recombinant Protein (Rat)
RP213464	ABM	100 ug	Ask for price

Monoclonal NDRG1 Antibody (monoclonal) (M03), Clone: 2D7
AMM03842G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NDRG1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2D7. This antibody is applicable in WB, IHC and IF, E

Phospho-NDRG1 (Ser330) Blocking Peptide
AF8493-BP	Affbiotech	1mg	EUR 195

Phospho-NDRG1 (Thr346) Blocking Peptide
AF8494-BP	Affbiotech	1mg	EUR 195

Ndrg1 ORF Vector (Rat) (pORF)
ORF071156	ABM	1.0 ug DNA	EUR 506

NDRG1 ORF Vector (Human) (pORF)
ORF006968	ABM	1.0 ug DNA	EUR 95

Ndrg1 ORF Vector (Mouse) (pORF)
ORF051135	ABM	1.0 ug DNA	EUR 506

NDRG1 ELISA Kit (Mouse) (OKEH05488)
OKEH05488	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Stress-responsive protein involved in hormone responses, cell growth, and differentiation. Acts as a tumor suppressor in many cell types. Necessary but not sufficient for p53/TP53-mediated caspase activation and apoptosis. Required for vesicular recycling of CDH1 and TF. May also function in lipid trafficking. Protects cells from spindle disruption damage. Functions in p53/TP53-dependent mitotic spindle checkpoint. Regulates microtubule dynamics and maintains euploidy. Has a role in cell trafficking notably of the Schwann cell and is necessary for the maintenance and development of the peripheral nerve myelin sheath.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.801 ng/mL

NDRG1 ELISA Kit (Bovine) (OKEH08032)
OKEH08032	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Anti-NDRG1 (Marker of Tumor Aggressiveness) Monoclonal Antibody
M01327	BosterBio	100ug/vial	EUR 397
Description: Mouse Monoclonal NDRG1 (Marker of Tumor Aggressiveness) Antibody. Validated in WB and tested in Human.

ELISA kit for Human Protein NDRG1
EK3420	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein NDRG1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Ndrg1 sgRNA CRISPR Lentivector set (Rat)
K6449601	ABM	3 x 1.0 ug	EUR 339

Ndrg1 sgRNA CRISPR Lentivector set (Mouse)
K4384501	ABM	3 x 1.0 ug	EUR 339

NDRG1 sgRNA CRISPR Lentivector set (Human)
K1407201	ABM	3 x 1.0 ug	EUR 339

Human N-myc Downstream Regulated 1 protein (NDRG1) Antibody
35749-05111	AssayPro	150 ug	EUR 261

Ndrg1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6449602	ABM	1.0 ug DNA	EUR 154

Ndrg1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6449603	ABM	1.0 ug DNA	EUR 154

Ndrg1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6449604	ABM	1.0 ug DNA	EUR 154

Ndrg1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4384502	ABM	1.0 ug DNA	EUR 154

Ndrg1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4384503	ABM	1.0 ug DNA	EUR 154

Ndrg1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4384504	ABM	1.0 ug DNA	EUR 154

NDRG1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1407202	ABM	1.0 ug DNA	EUR 154

NDRG1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1407203	ABM	1.0 ug DNA	EUR 154

NDRG1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1407204	ABM	1.0 ug DNA	EUR 154

NDRG1 Protein Vector (Mouse) (pPB-C-His)
PV204538	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Mouse) (pPB-N-His)
PV204539	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Mouse) (pPM-C-HA)
PV204540	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Mouse) (pPM-C-His)
PV204541	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Rat) (pPB-C-His)
PV284622	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Rat) (pPB-N-His)
PV284623	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Rat) (pPM-C-HA)
PV284624	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Rat) (pPM-C-His)
PV284625	ABM	500 ng	EUR 603

NDRG1 Protein Vector (Human) (pPB-C-His)
PV027869	ABM	500 ng	EUR 329

NDRG1 Protein Vector (Human) (pPB-N-His)
PV027870	ABM	500 ng	EUR 329

NDRG1 Protein Vector (Human) (pPM-C-HA)
PV027871	ABM	500 ng	EUR 329

NDRG1 Protein Vector (Human) (pPM-C-His)
PV027872	ABM	500 ng	EUR 329

Recombinant Human NDRG1 Protein, His, E.coli-10ug
QP10791-10ug	EnQuireBio	10ug	EUR 155

Recombinant Human NDRG1 Protein, His, E.coli-1mg
QP10791-1mg	EnQuireBio	1mg	EUR 1859

Recombinant Human NDRG1 Protein, His, E.coli-50ug
QP10791-50ug	EnQuireBio	50ug	EUR 201

Ndrg1 3'UTR Luciferase Stable Cell Line
TU113915	ABM	1.0 ml	Ask for price

Ndrg1 3'UTR GFP Stable Cell Line
TU163915	ABM	1.0 ml	Ask for price

Ndrg1 3'UTR Luciferase Stable Cell Line
TU213812	ABM	1.0 ml	Ask for price

Ndrg1 3'UTR GFP Stable Cell Line
TU263812	ABM	1.0 ml	Ask for price

NDRG1 3'UTR GFP Stable Cell Line
TU065475	ABM	1.0 ml	EUR 1521

NDRG1 3'UTR Luciferase Stable Cell Line
TU015475	ABM	1.0 ml	EUR 1521

NDRG1 ELISA Kit (Human) : 96 Wells (OKEH02359)
OKEH02359	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.21 ng/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

NDRG1 Rabbit Polyclonal Antibody