NDRG1 Rabbit Polyclonal Antibody

NDRG1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

Polyclonal NDRG1 Antibody
APR00120G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDRG1 . This antibody is tested and proven to work in the following applications:
NDRG1 Polyclonal Antibody
ABP59419-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDRG1 from Human, Mouse, Rat. This NDRG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350
NDRG1 Polyclonal Antibody
ABP59419-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDRG1 from Human, Mouse, Rat. This NDRG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350
NDRG1 Polyclonal Antibody
ABP59419-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDRG1 from Human, Mouse, Rat. This NDRG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDRG1 protein at amino acid sequence of 270-350
NDRG1 Polyclonal Antibody
ES9005-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NDRG1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NDRG1 Polyclonal Antibody
ES9005-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NDRG1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NDRG1 Rabbit mAb
A4050-100ul 100 ul
EUR 410
NDRG1 Rabbit mAb
A4050-200ul 200 ul
EUR 571
NDRG1 Rabbit mAb
A4050-20ul 20 ul
EUR 221
NDRG1 Rabbit mAb
A4050-50ul 50 ul
EUR 287
NDRG1 Rabbit pAb
A2142-100ul 100 ul
EUR 308
NDRG1 Rabbit pAb
A2142-200ul 200 ul
EUR 459
NDRG1 Rabbit pAb
A2142-20ul 20 ul
EUR 183
NDRG1 Rabbit pAb
A2142-50ul 50 ul
EUR 223
NDRG1 Polyclonal Conjugated Antibody
C30281 100ul
EUR 397
Protein NDRG1 (NDRG1) Antibody
abx117224-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody
abx122680-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody
20-abx142091
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody
abx033076-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody
abx033076-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody
20-abx242227
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody
abx431448-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Protein NDRG1 (NDRG1) Antibody
20-abx001754
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein NDRG1 (NDRG1) Antibody (Biotin)
abx431449-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
NDRG1 antibody
70R-1121 100 ug
EUR 377
Description: Rabbit polyclonal NDRG1 antibody raised against the N terminal of NDRG1
NDRG1 antibody
70R-1123 100 ug
EUR 377
Description: Rabbit polyclonal NDRG1 antibody raised against the C terminal of NDRG1
NDRG1 antibody
70R-13957 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal NDRG1 antibody
NDRG1 Antibody
3526-100
EUR 349
NDRG1 Antibody
3526-30T
EUR 146
NDRG1 Antibody
32622-100ul 100ul
EUR 252
NDRG1 Antibody
49614-100ul 100ul
EUR 333
NDRG1 Antibody
49614-50ul 50ul
EUR 239
NDRG1 Antibody
DF6865 200ul
EUR 304
Description: NDRG1 Antibody detects endogenous levels of total NDRG1.
NDRG1 Antibody
CSB-PA015610KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NDRG1. Recognizes NDRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
NDRG1 Antibody
CSB-PA015610KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NDRG1. Recognizes NDRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
NDRG1 Antibody
1-CSB-PA189423
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NDRG1. Recognizes NDRG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
NDRG1 Antibody
ABD6865 100 ug
EUR 438
[KO Validated] NDRG1 Polyclonal Antibody
30281-100ul 100ul
EUR 252
[KO Validated] NDRG1 Polyclonal Antibody
30281-50ul 50ul
EUR 187
Polyclonal NDRG1 Antibody (N-term)
APR05823G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDRG1 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-NDRG1 Antibody
APG00213G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NDRG1 . This antibody is tested and proven to work in the following applications:
Polyclonal NDRG1 Antibody (C-Terminus)
APG01076G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDRG1 (C-Terminus). This antibody is tested and proven to work in the following applications:
NDRG1 (Phospho-Thr346) Polyclonal Conjugated Antibody
C12767 100ul
EUR 397
Phospho-NDRG1-T346 Rabbit pAb
AP0792-100ul 100 ul
EUR 384
Phospho-NDRG1-T346 Rabbit pAb
AP0792-200ul 200 ul
EUR 554
Phospho-NDRG1-T346 Rabbit pAb
AP0792-20ul 20 ul
EUR 183
Phospho-NDRG1-T346 Rabbit pAb
AP0792-50ul 50 ul
EUR 265
Phospho-NDRG1-S330 Rabbit pAb
AP0807-100ul 100 ul
EUR 384
Phospho-NDRG1-S330 Rabbit pAb
AP0807-200ul 200 ul
EUR 554
Phospho-NDRG1-S330 Rabbit pAb
AP0807-20ul 20 ul
EUR 183
Phospho-NDRG1-S330 Rabbit pAb
AP0807-50ul 50 ul
EUR 265
[KO Validated] NDRG1 Rabbit pAb
A18057-100ul 100 ul
EUR 410
[KO Validated] NDRG1 Rabbit pAb
A18057-200ul 200 ul
EUR 571
[KO Validated] NDRG1 Rabbit pAb
A18057-20ul 20 ul
EUR 221
[KO Validated] NDRG1 Rabbit pAb
A18057-50ul 50 ul
EUR 287
Anti-NDRG1 Antibody
A01327-1 100ug/vial
EUR 294
NDRG1 (pS330) Antibody
abx217081-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
NDRG1 (pT346) Antibody
abx217082-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
NDRG1 Conjugated Antibody
C49614 100ul
EUR 397
NDRG1 Conjugated Antibody
C32622 100ul
EUR 397
Anti-NDRG1 Antibody
PA1416 100ug/vial
EUR 334
Anti-NDRG1 antibody
STJ11100030 100 µl
EUR 413
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-NDRG1 antibody
STJ24711 100 µl
EUR 277
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-NDRG1 antibody
STJ190163 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NDRG1
Anti-NDRG1 antibody
STJ70275 100 µg
EUR 359
Ndrg1/ Rat Ndrg1 ELISA Kit
ELI-22197r 96 Tests
EUR 886
Anti-NDRG1 Antibody Clone NDRG1/1383, Unconjugated-20ug
10397-MSM1-P0 20ug
EUR 233
Anti-NDRG1 Antibody Clone NDRG1/1383, Unconjugated-100ug
10397-MSM1-P1 100ug
EUR 428
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNUM1383-50 50uL
EUR 395
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383), 1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNUB1383-100 100uL
EUR 209
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383), Concentration: 0.2mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNUB1383-500 500uL
EUR 458
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383), Concentration: 0.2mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC551383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF555 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC551383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF555 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC611383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF660R conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC611383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF660R conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC471383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF647 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC471383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF647 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC051383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405M conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC051383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405M conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC401383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF640R conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC401383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF640R conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC431383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF543 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC431383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF543 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC041383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405S conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC041383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF405S conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC701383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF770 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC701383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF770 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC801383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC801383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCH1383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCH1383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCP1383-250 250uL
EUR 383
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),PerCP conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCR1383-250 250uL
EUR 383
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),RPE conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCA1383-250 250uL
EUR 383
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),APC conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCB1383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Biotin conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCB1383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Biotin conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC881383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF488A conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC881383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF488A conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC941383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF594 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC941383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF594 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC681383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF568 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC681383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF568 conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCAP1383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNCAP1383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC811383-100 100uL
EUR 199
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680R conjugate, Concentration: 0.1mg/mL
NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383) Antibody
BNC811383-500 500uL
EUR 544
Description: Primary antibody against NDRG1 (Marker of Tumor Aggressiveness) (NDRG1/1383),CF680R conjugate, Concentration: 0.1mg/mL
Human Protein NDRG1 (NDRG1) ELISA Kit
abx250909-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Ndrg1/ Protein NDRG1 ELISA Kit
E1662Mo 1 Kit
EUR 632
Human NDRG1/ Protein NDRG1 ELISA Kit
E1719Hu 1 Kit
EUR 605
Human NDRG1(Protein NDRG1) ELISA Kit
EH1617 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q92597
  • Alias: NDRG1/Protein NDRG1/Rit42/Reducing agents and tunicamycin-responsive protein/RTP/Nickel-specific induction protein Cap43/Differentiation-related gene 1 protein/DRG-1/N-myc downstream-regulated
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
Mouse Protein NDRG1, Ndrg1 ELISA KIT
ELI-16438m 96 Tests
EUR 865
Bovine Protein NDRG1, NDRG1 ELISA KIT
ELI-20679b 96 Tests
EUR 928
Human Protein NDRG1, NDRG1 ELISA KIT
ELI-20680h 96 Tests
EUR 824
Cow Protein NDRG1 (NDRG1) ELISA Kit
abx516974-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Protein NDRG1 (NDRG1) ELISA Kit
abx516976-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Protein NDRG1 (NDRG1) ELISA Kit
abx516977-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
NDRG1 siRNA
20-abx903500
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NDRG1 siRNA
20-abx925564
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NDRG1 siRNA
20-abx925565
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-NDRG1
YF-PA16929 50 ul
EUR 363
Description: Mouse polyclonal to NDRG1
anti-NDRG1
YF-PA27472 50 ug
EUR 363
Description: Mouse polyclonal to NDRG1
anti-NDRG1
YF-PA25566 50 ul
EUR 334
Description: Mouse polyclonal to NDRG1
NDRG1 (Phospho-Thr346) Antibody
12767-100ul 100ul
EUR 252
NDRG1 (Phospho-Thr346) Antibody
12767-50ul 50ul
EUR 187
Phospho-NDRG1 (Ser330) Antibody
AF8493 200ul
EUR 376
Description: NDRG1 (Phospho-Ser330) Antibody detects endogenous levels of NDRG1 only when phosphorylated at Ser330.
Phospho-NDRG1 (Thr346) Antibody
AF8494 200ul
EUR 376
Description: NDRG1 (Phospho-Thr346) Antibody detects endogenous levels of NDRG1 only when phosphorylated at Thr346.
NDRG1 (Phospho- Ser330) Antibody
ABF8493 100 ug
EUR 438
NDRG1 (Phospho- Thr346) Antibody
ABF8494 100 ug
EUR 438
Anti-NDRG1 Monoclonal Antibody
M01327-1 100ug
EUR 397
Description: Rabbit Monoclonal NDRG1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-NDRG1, Biotinylated antibody
STJ73261 100 µg
EUR 359
Ndrg1 ELISA Kit| Rat Protein NDRG1 ELISA Kit
EF019081 96 Tests
EUR 689
Ndrg1 ELISA Kit| Mouse Protein NDRG1 ELISA Kit
EF015705 96 Tests
EUR 689
NDRG1 ELISA Kit| Bovine Protein NDRG1 ELISA Kit
EF011673 96 Tests
EUR 689
NDRG1 Blocking Peptide
33R-3588 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NDRG1 antibody, catalog no. 70R-1123
NDRG1 Blocking Peptide
3526BP-50
EUR 153
NDRG1 Blocking Peptide
33R-6485 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NDRG1 antibody, catalog no. 70R-1121
Human Recombinant NDRG1
6391-100
EUR 370
NDRG1 Blocking Peptide
DF6865-BP 1mg
EUR 195
NDRG1 cloning plasmid
CSB-CL835678HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgtctcgggagatgcaggatgtagacctcgctgaggtgaagcctttggtggagaaaggggagaccatcaccggcctcctgcaagagtttgatgtccaggagcaggacatcgagactttacatggctctgttcacgtcacgctgtgtgggactcccaagggaaaccggcctgtca
  • Show more
Description: A cloning plasmid for the NDRG1 gene.
NDRG1 cloning plasmid
CSB-CL835678HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 330
  • Sequence: atggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctc
  • Show more
Description: A cloning plasmid for the NDRG1 gene.
Anti-NDRG1 (2D7)
YF-MA11279 100 ug
EUR 363
Description: Mouse monoclonal to NDRG1
Anti-Phospho-NDRG1-(T346) antibody
STJ117890 100 µl
EUR 393
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-Phospho-NDRG1-(S330) antibody
STJ117905 100 µl
EUR 393
Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
NDRG1 protein (His tag)
80R-1193 100 ug
EUR 224
Description: Purified recombinant Human NDRG1 protein
Human NDRG1 ELISA Kit
ELA-E14498h 96 Tests
EUR 824
NDRG1 ELISA KIT|Human
EF005769 96 Tests
EUR 689
Rat NDRG1 shRNA Plasmid
20-abx989014
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse NDRG1 shRNA Plasmid
20-abx971699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human NDRG1 shRNA Plasmid
20-abx957046
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NDRG1 Recombinant Protein (Human)
RP020902 100 ug Ask for price
NDRG1 Recombinant Protein (Mouse)
RP153401 100 ug Ask for price
NDRG1 Recombinant Protein (Rat)
RP213464 100 ug Ask for price
Monoclonal NDRG1 Antibody (monoclonal) (M03), Clone: 2D7
AMM03842G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NDRG1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2D7. This antibody is applicable in WB, IHC and IF, E
Phospho-NDRG1 (Ser330) Blocking Peptide
AF8493-BP 1mg
EUR 195
Phospho-NDRG1 (Thr346) Blocking Peptide
AF8494-BP 1mg
EUR 195
Ndrg1 ORF Vector (Rat) (pORF)
ORF071156 1.0 ug DNA
EUR 506
NDRG1 ORF Vector (Human) (pORF)
ORF006968 1.0 ug DNA
EUR 95
Ndrg1 ORF Vector (Mouse) (pORF)
ORF051135 1.0 ug DNA
EUR 506
NDRG1 ELISA Kit (Mouse) (OKEH05488)
OKEH05488 96 Wells
EUR 779
Description: Description of target: Stress-responsive protein involved in hormone responses, cell growth, and differentiation. Acts as a tumor suppressor in many cell types. Necessary but not sufficient for p53/TP53-mediated caspase activation and apoptosis. Required for vesicular recycling of CDH1 and TF. May also function in lipid trafficking. Protects cells from spindle disruption damage. Functions in p53/TP53-dependent mitotic spindle checkpoint. Regulates microtubule dynamics and maintains euploidy. Has a role in cell trafficking notably of the Schwann cell and is necessary for the maintenance and development of the peripheral nerve myelin sheath.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.801 ng/mL
NDRG1 ELISA Kit (Bovine) (OKEH08032)
OKEH08032 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Anti-NDRG1 (Marker of Tumor Aggressiveness) Monoclonal Antibody
M01327 100ug/vial
EUR 397
Description: Mouse Monoclonal NDRG1 (Marker of Tumor Aggressiveness) Antibody. Validated in WB and tested in Human.
ELISA kit for Human Protein NDRG1
EK3420 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein NDRG1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Ndrg1 sgRNA CRISPR Lentivector set (Rat)
K6449601 3 x 1.0 ug
EUR 339
Ndrg1 sgRNA CRISPR Lentivector set (Mouse)
K4384501 3 x 1.0 ug
EUR 339
NDRG1 sgRNA CRISPR Lentivector set (Human)
K1407201 3 x 1.0 ug
EUR 339
Human N-myc Downstream Regulated 1 protein (NDRG1) Antibody
35749-05111 150 ug
EUR 261
Ndrg1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6449602 1.0 ug DNA
EUR 154
Ndrg1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6449603 1.0 ug DNA
EUR 154
Ndrg1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6449604 1.0 ug DNA
EUR 154
Ndrg1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4384502 1.0 ug DNA
EUR 154
Ndrg1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4384503 1.0 ug DNA
EUR 154
Ndrg1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4384504 1.0 ug DNA
EUR 154
NDRG1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1407202 1.0 ug DNA
EUR 154
NDRG1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1407203 1.0 ug DNA
EUR 154
NDRG1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1407204 1.0 ug DNA
EUR 154
NDRG1 Protein Vector (Mouse) (pPB-C-His)
PV204538 500 ng
EUR 603
NDRG1 Protein Vector (Mouse) (pPB-N-His)
PV204539 500 ng
EUR 603
NDRG1 Protein Vector (Mouse) (pPM-C-HA)
PV204540 500 ng
EUR 603
NDRG1 Protein Vector (Mouse) (pPM-C-His)
PV204541 500 ng
EUR 603
NDRG1 Protein Vector (Rat) (pPB-C-His)
PV284622 500 ng
EUR 603
NDRG1 Protein Vector (Rat) (pPB-N-His)
PV284623 500 ng
EUR 603
NDRG1 Protein Vector (Rat) (pPM-C-HA)
PV284624 500 ng
EUR 603
NDRG1 Protein Vector (Rat) (pPM-C-His)
PV284625 500 ng
EUR 603
NDRG1 Protein Vector (Human) (pPB-C-His)
PV027869 500 ng
EUR 329
NDRG1 Protein Vector (Human) (pPB-N-His)
PV027870 500 ng
EUR 329
NDRG1 Protein Vector (Human) (pPM-C-HA)
PV027871 500 ng
EUR 329
NDRG1 Protein Vector (Human) (pPM-C-His)
PV027872 500 ng
EUR 329
Recombinant Human NDRG1 Protein, His, E.coli-10ug
QP10791-10ug 10ug
EUR 155
Recombinant Human NDRG1 Protein, His, E.coli-1mg
QP10791-1mg 1mg
EUR 1859
Recombinant Human NDRG1 Protein, His, E.coli-50ug
QP10791-50ug 50ug
EUR 201
Ndrg1 3'UTR Luciferase Stable Cell Line
TU113915 1.0 ml Ask for price
Ndrg1 3'UTR GFP Stable Cell Line
TU163915 1.0 ml Ask for price
Ndrg1 3'UTR Luciferase Stable Cell Line
TU213812 1.0 ml Ask for price
Ndrg1 3'UTR GFP Stable Cell Line
TU263812 1.0 ml Ask for price
NDRG1 3'UTR GFP Stable Cell Line
TU065475 1.0 ml
EUR 1521
NDRG1 3'UTR Luciferase Stable Cell Line
TU015475 1.0 ml
EUR 1521
NDRG1 ELISA Kit (Human) : 96 Wells (OKEH02359)
OKEH02359 96 Wells
EUR 831
Description: Description of target: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.21 ng/mL
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

NDRG1 Rabbit Polyclonal Antibody