GLP1R Rabbit Polyclonal Antibody

GLP1R Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

GLP1R Polyclonal Antibody

ES8938-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GLP1R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GLP1R Polyclonal Antibody

ES8938-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GLP1R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GLP1R Polyclonal Antibody

ABP57329-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of GLP1R from Human, Mouse, Rat. This GLP1R antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

GLP1R Polyclonal Antibody

ABP57329-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of GLP1R from Human, Mouse, Rat. This GLP1R antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

GLP1R Polyclonal Antibody

ABP57329-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of GLP1R from Human, Mouse, Rat. This GLP1R antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

GLP1R Polyclonal Antibody

ABP58644-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GLP1R protein
  • Applications tips:
Description: A polyclonal antibody for detection of GLP1R from Human, Mouse, Rat. This GLP1R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GLP1R protein

GLP1R Polyclonal Antibody

ABP58644-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GLP1R protein
  • Applications tips:
Description: A polyclonal antibody for detection of GLP1R from Human, Mouse, Rat. This GLP1R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GLP1R protein

GLP1R Polyclonal Antibody

ABP58644-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GLP1R protein
  • Applications tips:
Description: A polyclonal antibody for detection of GLP1R from Human, Mouse, Rat. This GLP1R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GLP1R protein

GLP1R Polyclonal Antibody

A53356 100 µg
EUR 570.55
Description: reagents widely cited

GLP1R Polyclonal Antibody

A55798 100 µg
EUR 570.55
Description: fast delivery possible

GLP1R Rabbit pAb

A13990-100ul 100 ul
EUR 308

GLP1R Rabbit pAb

A13990-200ul 200 ul
EUR 459

GLP1R Rabbit pAb

A13990-20ul 20 ul
EUR 183

GLP1R Rabbit pAb

A13990-50ul 50 ul
EUR 223

GLP1R Rabbit pAb

A8547-100ul 100 ul
EUR 308

GLP1R Rabbit pAb

A8547-200ul 200 ul
EUR 459

GLP1R Rabbit pAb

A8547-20ul 20 ul
EUR 183

GLP1R Rabbit pAb

A8547-50ul 50 ul
EUR 223

Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

DLR-GLP1R-Hu-48T 48T
EUR 517
  • Should the Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glucagon Like Peptide 1 Receptor (GLP1R) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

DLR-GLP1R-Hu-96T 96T
EUR 673
  • Should the Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glucagon Like Peptide 1 Receptor (GLP1R) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

DLR-GLP1R-Mu-48T 48T
EUR 527
  • Should the Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glucagon Like Peptide 1 Receptor (GLP1R) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

DLR-GLP1R-Mu-96T 96T
EUR 688
  • Should the Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glucagon Like Peptide 1 Receptor (GLP1R) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RD-GLP1R-Hu-48Tests 48 Tests
EUR 521

Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RD-GLP1R-Hu-96Tests 96 Tests
EUR 723

Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RD-GLP1R-Mu-48Tests 48 Tests
EUR 533

Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RD-GLP1R-Mu-96Tests 96 Tests
EUR 740

Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RDR-GLP1R-Hu-48Tests 48 Tests
EUR 544

Human Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RDR-GLP1R-Hu-96Tests 96 Tests
EUR 756

Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RDR-GLP1R-Mu-48Tests 48 Tests
EUR 557

Mouse Glucagon Like Peptide 1 Receptor (GLP1R) ELISA Kit

RDR-GLP1R-Mu-96Tests 96 Tests
EUR 774

Polyclonal GLP1R Antibody (internal region)

APG03343G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GLP1R (internal region). This antibody is tested and proven to work in the following applications:

GLP1R Polyclonal Antibody, Biotin Conjugated

A53353 100 µg
EUR 570.55
Description: fast delivery possible

GLP1R Polyclonal Antibody, FITC Conjugated

A53354 100 µg
EUR 570.55
Description: reagents widely cited

GLP1R Polyclonal Antibody, HRP Conjugated

A53355 100 µg
EUR 570.55
Description: Ask the seller for details

GLP1R Polyclonal Antibody, HRP Conjugated

A55799 100 µg
EUR 570.55
Description: reagents widely cited

GLP1R Polyclonal Antibody, FITC Conjugated

A55800 100 µg
EUR 570.55
Description: Ask the seller for details

GLP1R Polyclonal Antibody, Biotin Conjugated

A55801 100 µg
EUR 570.55
Description: The best epigenetics products

GLP1R antibody

70R-30900 100 ug
EUR 327
Description: Rabbit polyclonal GLP1R antibody

GLP1R Antibody

ABD7750 100 ug
EUR 438

GLP1R Antibody

35757-100ul 100ul
EUR 252

GLP1R Antibody

DF7750 200ul
EUR 304
Description: GLP1R Antibody detects endogenous levels of total GLP1R.

GLP1R Antibody

1-CSB-PA002699
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/5000

Glp1r Antibody

1-CSB-PA009514HA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Glp1r. Recognizes Glp1r from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

GLP1R Antibody

1-CSB-PA009514LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

GLP1R Antibody

1-CSB-PA009514YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200

GLP1R Antibody

1-CSB-PA183226
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

GLP1R Conjugated Antibody

C35757 100ul
EUR 397

Anti-GLP1R antibody

STJ72860 100 µg
EUR 359

Anti-GLP1R antibody

STJ99656 200 µl
EUR 197
Description: Rabbit polyclonal to GLP1R.

Anti-GLP1R antibody

STJ97576 200 µl
EUR 197
Description: Rabbit polyclonal to GLP1R (A233).

Anti-GLP1R antibody

STJ111286 100 µl
EUR 277
Description: This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants.

Anti-GLP1R antibody

STJ115925 100 µl
EUR 277
Description: This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants.

GLP1R siRNA

20-abx902183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GLP1R siRNA

20-abx918017
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GLP1R siRNA

20-abx918018
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GLP1R- Tango

PVT11514 2 ug
EUR 304

Glp1r Antibody, HRP conjugated

1-CSB-PA009514HB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Glp1r. Recognizes Glp1r from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Glp1r Antibody, FITC conjugated

1-CSB-PA009514HC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Glp1r. Recognizes Glp1r from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Glp1r Antibody, Biotin conjugated

1-CSB-PA009514HD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Glp1r. Recognizes Glp1r from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

GLP1R Antibody, HRP conjugated

1-CSB-PA009514LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GLP1R Antibody, FITC conjugated

1-CSB-PA009514LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GLP1R Antibody, Biotin conjugated

1-CSB-PA009514LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GLP1R Antibody, HRP conjugated

1-CSB-PA009514YB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GLP1R Antibody, FITC conjugated

1-CSB-PA009514YC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GLP1R Antibody, Biotin conjugated

1-CSB-PA009514YD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GLP1R. Recognizes GLP1R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal GLP1R / GLP-1 Receptor Antibody (N-Terminus)

AMM05919G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP1R / GLP-1 Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GLP1R / GLP-1 Receptor Antibody (C-Terminus)

APG03340G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP1R / GLP-1 Receptor (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GLP1R / GLP-1 Receptor Antibody (Cytoplasmic Domain)

APG03341G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP1R / GLP-1 Receptor (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GLP1R / GLP-1 Receptor Antibody (N-Terminus)

APG03342G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP1R / GLP-1 Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

GLP1R cloning plasmid

CSB-CL009514HU-10ug 10ug
EUR 499
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1392
  • Sequence: atggccggcgcccccggcccgctgcgccttgcgctgctgctgctcgggatggtgggcagggccggcccccgcccccagggtgccactgtgtccctctgggagacggtgcagaaatggcgagaataccgacgccagtgccagcgctccctgactgaggatccacctcctgccacag
  • Show more
Description: A cloning plasmid for the GLP1R gene.

GLP1R Blocking Peptide

DF7750-BP 1mg
EUR 195

Recombinant rat GLP1R

P2095 100ug Ask for price
  • Uniprot ID: P32301
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for rat GLP1R

pCDNA3.1-Glp1r-m

PVT12357 2 ug
EUR 703

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse)

4-PAD475Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R)

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), APC

4-PAD475Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with APC.

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), Biotinylated

4-PAD475Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with Biotin.

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), Cy3

4-PAD475Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with Cy3.

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), FITC

4-PAD475Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with FITC.

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), HRP

4-PAD475Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with HRP.

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), PE

4-PAD475Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with PE.

Rat GLP1R shRNA Plasmid

20-abx984762
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GLP1R ELISA Kit

ELA-E10276h 96 Tests
EUR 824

GLP1R ELISA KIT|Human

EF002155 96 Tests
EUR 689

Mouse GLP1R shRNA Plasmid

20-abx970560
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GLP1R shRNA Plasmid

20-abx951824
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GLP1R Recombinant Protein (Human)

RP039490 100 ug Ask for price

GLP1R Recombinant Protein (Rat)

RP202796 100 ug Ask for price

GLP1R Recombinant Protein (Mouse)

RP136718 100 ug Ask for price

Glucagon Like Peptide 1 Receptor (GLP1R) Polyclonal Antibody (Mouse), APC-Cy7

4-PAD475Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GLP1R (Pro25~Tyr145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glucagon Like Peptide 1 Receptor (GLP1R). This antibody is labeled with APC-Cy7.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody

20-abx123823
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon Like Peptide 1 Receptor (GLP1R) Antibody

20-abx129903
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody

20-abx109815
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody

20-abx109816
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon Like Peptide 1 Receptor (GLP1R) Antibody

20-abx172550
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glucagon Like Peptide 1 Receptor (GLP1R) Antibody

20-abx176597
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glucagon Like Peptide 1 Receptor (GLP1R) Antibody

20-abx176598
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glucagon Like Peptide 1 Receptor (GLP1R) Antibody

20-abx325722
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (Glp1r) Antibody

20-abx318964
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody

abx431288-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Glucagon Like Peptide 1 Receptor (GLP1R) Antibody

20-abx241224
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glp1r ORF Vector (Rat) (pORF)

ORF067600 1.0 ug DNA
EUR 506

h GLP1R inducible lentiviral particles

LVP902 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: GLP1R (glucagon like peptide 1 receptor ), [alternative names: GLP-1R; GLP-1-R]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_002062.3. . It also contains a RFP-Blasticidin dual selection marker.

Glp1r ORF Vector (Mouse) (pORF)

ORF045574 1.0 ug DNA
EUR 506

GLP1R ORF Vector (Human) (pORF)

ORF013164 1.0 ug DNA
EUR 95

GLP1R ELISA Kit (Human) (OKAN05513)

OKAN05513 96 Wells
EUR 792
Description: Description of target: This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

GLP1R ELISA Kit (Rat) (OKAN06229)

OKAN06229 96 Wells
EUR 792
Description: Description of target: induces insulin secretion; mediates neuroendocrine signaling of feeding behavior; mediates cardiovascular response and increased blood pressure [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

GLP1R ELISA Kit (Mouse) (OKAN06331)

OKAN06331 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

GLP1R ELISA Kit (Human) (OKCD08488)

OKCD08488 96 Wells
EUR 975
Description: Description of target: This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

GLP1R ELISA Kit (Mouse) (OKCD08489)

OKCD08489 96 Wells
EUR 1001
Description: Description of target: This is a receptor for glucagon-like peptide 1. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

GLP1R ELISA Kit (Rat) (OKCD08490)

OKCD08490 96 Wells
EUR 1053
Description: Description of target: induces insulin secretion; mediates neuroendocrine signaling of feeding behavior; mediates cardiovascular response and increased blood pressure.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

GLP1R ELISA Kit (Mouse) (OKEH03586)

OKEH03586 96 Wells
EUR 779
Description: Description of target: This is a receptor for glucagon-like peptide 1. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody (HRP)

20-abx108289
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody (HRP)

20-abx108290
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody (Biotin)

20-abx105451
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody (Biotin)

20-abx105452
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody (FITC)

20-abx106869
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (GLP1R) Antibody (FITC)

20-abx106870
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (Glp1r) Antibody (HRP)

20-abx319276
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (Glp1r) Antibody (FITC)

20-abx319277
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 1 Receptor (Glp1r) Antibody (Biotin)

20-abx319278
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GLP1R sgRNA CRISPR Lentivector set (Human)

K0867101 3 x 1.0 ug
EUR 339

Glp1r sgRNA CRISPR Lentivector set (Mouse)

K4446301 3 x 1.0 ug
EUR 339

Glp1r sgRNA CRISPR Lentivector set (Rat)

K6836801 3 x 1.0 ug
EUR 339

Recombinant GLP1R Protein (Arg24-Tyr145) [His]

VAng-Cr3779-100g 100 µg
EUR 1388
Description: Recombinant GLP1R Protein (Arg24-Tyr145) fused with a His tag at N-terminus was expressed in Mammalian cells, with a molecular weight of 45-66 kDa. (Uniprot ID: P43220)

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GLP1R Rabbit Polyclonal Antibody