VHL Rabbit Polyclonal Antibody

VHL Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

VHL Polyclonal Antibody

ABP60891-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody

ABP60891-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody

ABP60891-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody

ABP56500-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody

ABP56500-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody

ABP56500-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody

46866-100ul 100ul
EUR 252

VHL Polyclonal Antibody

46866-50ul 50ul
EUR 187

VHL Rabbit pAb

A0377-100ul 100 ul
EUR 308

VHL Rabbit pAb

A0377-200ul 200 ul
EUR 459

VHL Rabbit pAb

A0377-20ul 20 ul
EUR 183

VHL Rabbit pAb

A0377-50ul 50 ul
EUR 223

VHL Rabbit pAb

A11240-100ul 100 ul
EUR 308

VHL Rabbit pAb

A11240-200ul 200 ul
EUR 459

VHL Rabbit pAb

A11240-20ul 20 ul
EUR 183

VHL Rabbit pAb

A11240-50ul 50 ul
EUR 223

VHL Rabbit pAb

A16287-100ul 100 ul
EUR 308

VHL Rabbit pAb

A16287-200ul 200 ul
EUR 459

VHL Rabbit pAb

A16287-20ul 20 ul
EUR 183

VHL Rabbit pAb

A16287-50ul 50 ul
EUR 223

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Hu-48T 48T
EUR 549
  • Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Hu-96T 96T
EUR 718
  • Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Ra-48T 48T
EUR 549
  • Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids.

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Ra-96T 96T
EUR 718
  • Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Hu-48Tests 48 Tests
EUR 583

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Hu-96Tests 96 Tests
EUR 811

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Ra-48Tests 48 Tests
EUR 583

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Ra-96Tests 96 Tests
EUR 811

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Hu-48Tests 48 Tests
EUR 557

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Hu-96Tests 96 Tests
EUR 775

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Ra-48Tests 48 Tests
EUR 557

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Ra-96Tests 96 Tests
EUR 775

Polyclonal VHL Antibody (C-term)

APR10723G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-VHL Antibody

AMM05157G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VHL . This antibody is tested and proven to work in the following applications:

VHL (phospho Ser68) Polyclonal Antibody

ES7498-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL (phospho Ser68) Polyclonal Antibody

ES7498-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL (phospho Ser68) Polyclonal Antibody

ABP56499-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody

ABP56499-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody

ABP56499-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL Antibody

AF6292 200ul
EUR 304
Description: VHL Antibody detects endogenous levels of total VHL.

VHL Antibody

ABF6292 100 ug
EUR 438

VHL antibody

70R-34605 100 ug
EUR 327
Description: Purified Rabbit polyclonal VHL antibody

VHL antibody

70R-9757 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VHL antibody

VHL Antibody

ABD6104 100 ug
EUR 438

VHL antibody

10R-1029 100 ul
EUR 316
Description: Mouse monoclonal VHL antibody

VHL Antibody

32075-100ul 100ul
EUR 252

VHL Antibody

DF6104 200ul
EUR 304
Description: VHL Antibody detects endogenous levels of total VHL.

VHL Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

VHL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

VHL Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VHL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

VHL Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VHL Antibody

CSB-PA025852KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VHL (Phospho-Ser68) Polyclonal Conjugated Antibody

C12654 100ul
EUR 397

VHL Conjugated Antibody

C32075 100ul
EUR 397

anti- VHL antibody

FNab09402 100µg
EUR 548.75
  • Recommended dilution: IF: 1:10-1:100
  • IHC: 1:20-1:200
  • Immunogen: von Hippel-Lindau tumor suppressor
  • Uniprot ID: P40337
  • Gene ID: 7428
  • Research Area: Cancer, Metabolism
Description: Antibody raised against VHL

anti- VHL antibody

FNab10175 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: Histone-lysine N-methyltransferase EZH2
  • Uniprot ID: P40337
  • Gene ID: 7428
Description: Antibody raised against VHL

VHL (pS68) Antibody

abx219320-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Human VHL Antibody

32825-05111 150 ug
EUR 261

Anti-VHL antibody

PAab09402 100 ug
EUR 386

Anti-VHL Antibody

STJ502735 100 µg
EUR 476

Anti-VHL antibody

STJ70964 100 µg
EUR 359

Anti-VHL antibody

STJ98809 200 µl
EUR 197
Description: Rabbit polyclonal to VHL.

Anti-VHL antibody

STJ96241 200 µl
EUR 197
Description: Rabbit polyclonal to VHL.

Anti-VHL antibody

STJ26089 100 µl
EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody

STJ113440 50 µl
EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody

STJ113742 100 µl
EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody

STJ118733 100 µl
EUR 277


ELA-E1894r 96 Tests
EUR 886

Vhl/ Rat Vhl ELISA Kit

ELI-06080r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-VHL (Ser68) Antibody

AF8334 200ul
EUR 376
Description: VHL (Phospho-Ser68) Antibody detects endogenous levels of VHL only when phosphorylated at Ser68.

VHL (Phospho- Ser68) Antibody

ABF8334 100 ug
EUR 438

VHL (Phospho-Ser68) Antibody

12654-100ul 100ul
EUR 252

VHL (Phospho-Ser68) Antibody

12654-50ul 50ul
EUR 187

Phospho-VHL (S68) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-VHL (S68). Recognizes Phospho-VHL (S68) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Anti-VHL, Biotinylated antibody

STJ73173 100 µg
EUR 359

Anti-VHL Antibody (Biotin)

STJ502736 100 µg
EUR 586

Anti-VHL Antibody (FITC)

STJ502737 100 µg
EUR 586

Polyclonal VHL / Von Hippel Lindau Antibody (aa34-83)

APR10721G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL / Von Hippel Lindau (aa34-83). This antibody is tested and proven to work in the following applications:

VHL Blocking Peptide

AF6292-BP 1mg
EUR 195

VHL cloning plasmid

CSB-CL025852HU-10ug 10ug
EUR 255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggcc
  • Show more
Description: A cloning plasmid for the VHL gene.

VHL Mouse mAb

A11872-100ul 100 ul Ask for price

VHL Mouse mAb

A11872-200ul 200 ul Ask for price

VHL Mouse mAb

A11872-20ul 20 ul Ask for price

VHL Mouse mAb

A11872-50ul 50 ul
EUR 265

VHL Blocking Peptide

33R-2312 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VHL antibody, catalog no. 70R-9757

VHL Blocking Peptide

DF6104-BP 1mg
EUR 195

Recombinant human VHL

P2120 100ug Ask for price
  • Uniprot ID: P40337
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VHL

Human VHL Antibody (Biotin Conjugate)

32825-05121 150 ug
EUR 369

Anti-Phospho-VHL (S68) antibody

STJ91273 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-VHL (S68).

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL)

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with APC.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with Biotin.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with Cy3.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with FITC.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with HRP.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with PE.

Human VHL AssayLite Antibody (FITC Conjugate)

32825-05141 150 ug
EUR 428

Human VHL AssayLite Antibody (RPE Conjugate)

32825-05151 150 ug
EUR 428

Human VHL AssayLite Antibody (APC Conjugate)

32825-05161 150 ug
EUR 428

Human VHL AssayLite Antibody (PerCP Conjugate)

32825-05171 150 ug
EUR 471

Rat VHL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E1894h 96 Tests
EUR 824


ELI-06083d 96 Tests
EUR 928


EF006088 96 Tests
EUR 689

Human VHL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VHL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VHL Recombinant Protein (Human)

RP034324 100 ug Ask for price

VHL Recombinant Protein (Rat)

RP236390 100 ug Ask for price

VHL Recombinant Protein (Mouse)

RP183791 100 ug Ask for price

pCMV-HA-VHL Plasmid

PVTB00168-2a 2 ug
EUR 356

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with APC-Cy7.

Monoclonal VHL Antibody (monoclonal) (M01), Clone: 1G12

APR10724G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human VHL (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1G12. This antibody is applicable in WB and IF, E

Von Hippel Lindau Tumor Suppressor (vHL) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Von Hippel Lindau Tumor Suppressor (vHL) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Von Hippel Lindau Tumor Suppressor (VHL) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Von Hippel Lindau Tumor Suppressor (VHL) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Von Hippel Lindau Tumor Suppressor (VHL) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Von Hippel Lindau Tumor Suppressor (VHL) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-VHL (Ser68) Blocking Peptide

AF8334-BP 1mg
EUR 195

Vhl ORF Vector (Rat) (pORF)

ORF078798 1.0 ug DNA
EUR 506

VHL ORF Vector (Human) (pORF)

ORF011442 1.0 ug DNA
EUR 95

Vhl ORF Vector (Mouse) (pORF)

ORF061265 1.0 ug DNA
EUR 506

VHL ELISA Kit (Rat) (OKCD02977)

OKCD02977 96 Wells
EUR 896
Description: Description of target: Involved in the ubiquitination and subsequent proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Seems to act as a target recruitment subunit in the E3 ubiquitin ligase complex and recruits hydroxylated hypoxia-inducible factor (HIF) under normoxic conditions. Involved in transcriptional repression through interaction with HIF1A, HIF1AN and histone deacetylases. Ubiquitinates, in an oxygen-responsive manner, ADRB2. <p>This subsection of the <a href="//www.uniprot.org/help/function_section">‘Function’</a> section describes the metabolic pathway(s) associated with a protein.<p><a href='/help/pathway' target='_top'>More...</a></p>Pathwayi: protein ubiquitinationThis protein is involved in the pathway protein ubiquitination, which is part of Protein modification._x000D_View all proteins of this organism that are known to be involved in the pathway protein ubiquitination and in Protein modification. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

VHL ELISA Kit (Mouse) (OKEH05306)

OKEH05306 96 Wells
EUR 662
Description: Description of target: Involved in the ubiquitination and subsequent proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Seems to act as a target recruitment subunit in the E3 ubiquitin ligase complex and recruits hydroxylated hypoxia-inducible factor (HIF) under normoxic conditions. Involved in transcriptional repression through interaction with HIF1A, HIF1AN and histone deacetylases. Ubiquitinates, in an oxygen-responsive manner, ADRB2.

This subsection of the ‘Function’ section describes the metabolic pathway(s) associated with a protein.

More..;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

VHL ELISA Kit (Rat) (OKEH07205)

OKEH07205 96 Wells
EUR 662
Description: Description of target: Involved in the ubiquitination and subsequent proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Seems to act as a target recruitment subunit in the E3 ubiquitin ligase complex and recruits hydroxylated hypoxia-inducible factor (HIF) under normoxic conditions. Involved in transcriptional repression through interaction with HIF1A, HIF1AN and histone deacetylases. Ubiquitinates, in an oxygen-responsive manner, ADRB2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

Mouse Anti-Human VHL monoclonal antibody, clone JID794

CABT-L2880-100uL500uL 100 uL, 500 uL
EUR 502

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx125410-50ul 50 ul
EUR 356
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx117007-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx032864-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx032864-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx032865-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx032865-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx012353-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx219331-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx431703-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody

abx239402-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

VHL protein, betadomain protein (His tag)

80R-1008 100 ug
EUR 224
Description: Purified recombinant Human VHL protein, betadomain protein

VHL sgRNA CRISPR Lentivector set (Human)

K2611301 3 x 1.0 ug
EUR 339

Vhl sgRNA CRISPR Lentivector set (Mouse)

K4414101 3 x 1.0 ug
EUR 339

Vhl sgRNA CRISPR Lentivector set (Rat)

K6798701 3 x 1.0 ug
EUR 339

Von Hippel-Lindau Disease Tumor Suppressor (VHL) Antibody (Biotin)

abx431704-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

VHL sgRNA CRISPR Lentivector (Human) (Target 1)

K2611302 1.0 ug DNA
EUR 154

VHL sgRNA CRISPR Lentivector (Human) (Target 2)

K2611303 1.0 ug DNA
EUR 154

VHL sgRNA CRISPR Lentivector (Human) (Target 3)

K2611304 1.0 ug DNA
EUR 154

Vhl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4414102 1.0 ug DNA
EUR 154

Vhl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4414103 1.0 ug DNA
EUR 154

Vhl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4414104 1.0 ug DNA
EUR 154

Vhl sgRNA CRISPR Lentivector (Rat) (Target 1)

K6798702 1.0 ug DNA
EUR 154

Vhl sgRNA CRISPR Lentivector (Rat) (Target 2)

K6798703 1.0 ug DNA
EUR 154

Vhl sgRNA CRISPR Lentivector (Rat) (Target 3)

K6798704 1.0 ug DNA
EUR 154

VHL Protein Vector (Human) (pPB-C-His)

PV045765 500 ng
EUR 329

VHL Protein Vector (Human) (pPB-N-His)

PV045766 500 ng
EUR 329

VHL Protein Vector (Human) (pPM-C-HA)

PV045767 500 ng
EUR 329

VHL Protein Vector (Human) (pPM-C-His)

PV045768 500 ng
EUR 329

Recombinant Von Hippel Lindau Tumor Suppressor (vHL)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q64259
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Von Hippel Lindau Tumor Suppressor expressed in: E.coli

Recombinant Human VHL Protein, His, E.coli-10ug

QP13934-10ug 10ug
EUR 155

Recombinant Human VHL Protein, His, E.coli-1mg

QP13934-1mg 1mg
EUR 1859

Recombinant Human VHL Protein, His, E.coli-50ug

QP13934-50ug 50ug
EUR 201

VHL Protein Vector (Rat) (pPB-C-His)

PV315190 500 ng
EUR 603

VHL Protein Vector (Rat) (pPB-N-His)

PV315191 500 ng
EUR 603

VHL Protein Vector (Rat) (pPM-C-HA)

PV315192 500 ng
EUR 603

VHL Protein Vector (Rat) (pPM-C-His)

PV315193 500 ng
EUR 603

VHL Protein Vector (Mouse) (pPB-C-His)

PV245058 500 ng
EUR 603

VHL Protein Vector (Mouse) (pPB-N-His)

PV245059 500 ng
EUR 603

VHL Protein Vector (Mouse) (pPM-C-HA)

PV245060 500 ng
EUR 603

VHL Protein Vector (Mouse) (pPM-C-His)

PV245061 500 ng
EUR 603

Vhl 3'UTR GFP Stable Cell Line

TU171762 1.0 ml Ask for price

VHL 3'UTR GFP Stable Cell Line

TU078117 1.0 ml
EUR 1521

VHL Rabbit Polyclonal Antibody