CD300e Rabbit Polyclonal Antibody

CD300e Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CD300e Polyclonal Antibody
46816-50ul 50ul
EUR 187
CD300e Polyclonal Antibody
ABP58061-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CD300e from Human. This CD300e antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
CD300e Polyclonal Antibody
ABP58061-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CD300e from Human. This CD300e antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
CD300e Polyclonal Antibody
ABP58061-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CD300e from Human. This CD300e antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
CD300e Polyclonal Antibody
ES8686-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD300e from Human. This antibody is tested and validated for IHC, WB, ELISA
CD300e Polyclonal Antibody
ES8686-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD300e from Human. This antibody is tested and validated for IHC, WB, ELISA
CD300E Antibody
46436-100ul 100ul
EUR 252
CD300E Antibody
1-CSB-PA405404
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CD300E. Recognizes CD300E from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000
Anti-CD300e antibody
STJ98749 200 µl
EUR 197
Description: Rabbit polyclonal to CD300e.
CD300E siRNA
20-abx910996
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD300E siRNA
20-abx910997
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CD300e
YF-PA23001 50 ul
EUR 363
Description: Mouse polyclonal to CD300e
Anti-CD300e/Lmir6 Antibody
A11226 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD300e Antibody (CD300E) detection.tested for IHC in Human.
CD300E cloning plasmid
CSB-CL673210HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGTGGCTGCTCCCAGCTCTACTCCTTCTCTGCCTCTCAGGCTGTTTGTCTCTGAAGGGCCCCGGCTCTGTGACTGGCACTGCGGGGGACTCTCTGACAGTGTGGTGTCAGTATGAGAGCATGTACAAGGGATATAACAAGTACTGGTGCCGAGGACAGTACGACACGTCATGTGA
  • Show more
Description: A cloning plasmid for the CD300E gene.
Rabbit CMRF35 like molecule 2(CD300E) ELISA kit
E04C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CMRF35 like molecule 2(CD300E) ELISA kit
E04C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CMRF35 like molecule 2(CD300E) ELISA kit
E04C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Anti-Hu CD300e Purified
11-728-C025 0.025 mg
EUR 99
Anti-Hu CD300e Purified
11-728-C100 0.1 mg
EUR 158
Anti-Hu CD300e APC
1A-728-T025 25 tests
EUR 140
Anti-Hu CD300e APC
1A-728-T100 100 tests
EUR 240
Anti-Hu CD300e PE
1P-728-T025 25 tests
EUR 140
Anti-Hu CD300e PE
1P-728-T100 100 tests
EUR 240
CD300E protein (His tag)
80R-3997 100 ug
EUR 349
Description: Recombinant Human CD300E protein
CD300E ELISA KIT|Human
EF004729 96 Tests
EUR 689
Human CD300E shRNA Plasmid
20-abx967397
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CD300E shRNA Plasmid
20-abx981107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CD300E Human Recombinant Protein
PROTQ496F6 Regular: 20ug
EUR 317
Description: CD300E Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (18-173 a.a) and having a molecular mass of 19.9kDa.;CD300E is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
CD300E Recombinant Protein (Human)
RP037909 100 ug Ask for price
CD300E Recombinant Protein (Rat)
RP193925 100 ug Ask for price
CD300E Recombinant Protein (Mouse)
RP122510 100 ug Ask for price
CMRF35-Like Molecule 2 (CD300e) Antibody
abx140158-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.
CMRF35-Like Molecule 2 (CD300e) Antibody
abx140408-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.
CMRF35-Like Molecule 2 (CD300E) Antibody
abx030830-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
CMRF35-Like Molecule 2 (CD300E) Antibody
abx030830-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
CMRF35-like molecule 2 (CD300E) Antibody
20-abx323211
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
CMRF35-Like Molecule 2 (CD300e) Antibody (APC)
abx140159-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
CMRF35-Like Molecule 2 (CD300e) Antibody (PE)
abx140160-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
Cd300e ORF Vector (Rat) (pORF)
ORF064643 1.0 ug DNA
EUR 506
CD300E ORF Vector (Human) (pORF)
ORF012637 1.0 ug DNA
EUR 354
Cd300e ORF Vector (Mouse) (pORF)
ORF040838 1.0 ug DNA
EUR 506
Anti-Hu CD300e Pacific Blue
PB-728-T100 100 tests
EUR 269
Anti-Hu CD300e Purified Low Endotoxin
12-728-C100 0.1 mg
EUR 158
CD300E sgRNA CRISPR Lentivector set (Human)
K0407601 3 x 1.0 ug
EUR 339
Cd300e sgRNA CRISPR Lentivector set (Rat)
K6163501 3 x 1.0 ug
EUR 339
Cd300e sgRNA CRISPR Lentivector set (Mouse)
K4031701 3 x 1.0 ug
EUR 339
CD300E sgRNA CRISPR Lentivector (Human) (Target 1)
K0407602 1.0 ug DNA
EUR 154
CD300E sgRNA CRISPR Lentivector (Human) (Target 2)
K0407603 1.0 ug DNA
EUR 154
CD300E sgRNA CRISPR Lentivector (Human) (Target 3)
K0407604 1.0 ug DNA
EUR 154
Cd300e sgRNA CRISPR Lentivector (Rat) (Target 1)
K6163502 1.0 ug DNA
EUR 154
Cd300e sgRNA CRISPR Lentivector (Rat) (Target 2)
K6163503 1.0 ug DNA
EUR 154
Cd300e sgRNA CRISPR Lentivector (Rat) (Target 3)
K6163504 1.0 ug DNA
EUR 154
Cd300e sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4031702 1.0 ug DNA
EUR 154
Cd300e sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4031703 1.0 ug DNA
EUR 154
Cd300e sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4031704 1.0 ug DNA
EUR 154
CD300E Protein Vector (Mouse) (pPB-C-His)
PV163350 500 ng
EUR 603
CD300E Protein Vector (Mouse) (pPB-N-His)
PV163351 500 ng
EUR 603
CD300E Protein Vector (Mouse) (pPM-C-HA)
PV163352 500 ng
EUR 603
CD300E Protein Vector (Mouse) (pPM-C-His)
PV163353 500 ng
EUR 603
CD300E Protein Vector (Rat) (pPB-C-His)
PV258570 500 ng
EUR 603
CD300E Protein Vector (Rat) (pPB-N-His)
PV258571 500 ng
EUR 603
CD300E Protein Vector (Rat) (pPM-C-HA)
PV258572 500 ng
EUR 603
CD300E Protein Vector (Rat) (pPM-C-His)
PV258573 500 ng
EUR 603
CD300E Protein Vector (Human) (pPB-C-His)
PV050545 500 ng
EUR 481
CD300E Protein Vector (Human) (pPB-N-His)
PV050546 500 ng
EUR 481
CD300E Protein Vector (Human) (pPM-C-HA)
PV050547 500 ng
EUR 481
CD300E Protein Vector (Human) (pPM-C-His)
PV050548 500 ng
EUR 481
Recombinant Human CD300E Protein, His, E.coli-1mg
QP11326-1mg 1mg
EUR 2757
Recombinant Human CD300E Protein, His, E.coli-20ug
QP11326-20ug 20ug
EUR 201
Recombinant Human CD300E Protein, His, E.coli-5ug
QP11326-5ug 5ug
EUR 155
Cd300e 3'UTR GFP Stable Cell Line
TU153488 1.0 ml Ask for price
Cd300e 3'UTR Luciferase Stable Cell Line
TU103488 1.0 ml Ask for price
Cd300e 3'UTR Luciferase Stable Cell Line
TU201964 1.0 ml Ask for price
Cd300e 3'UTR GFP Stable Cell Line
TU251964 1.0 ml Ask for price
CD300E 3'UTR GFP Stable Cell Line
TU053948 1.0 ml
EUR 1521
CD300E 3'UTR Luciferase Stable Cell Line
TU003948 1.0 ml
EUR 1521
Rat CMRF35 like molecule 2(CD300E) ELISA kit
E02C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CMRF35 like molecule 2(CD300E) ELISA kit
E02C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CMRF35 like molecule 2(CD300E) ELISA kit
E02C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CMRF35 like molecule 2(CD300E) ELISA kit
E06C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CMRF35 like molecule 2(CD300E) ELISA kit
E06C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CMRF35 like molecule 2(CD300E) ELISA kit
E06C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CMRF35 like molecule 2(CD300E) ELISA kit
E03C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CMRF35 like molecule 2(CD300E) ELISA kit
E03C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CMRF35 like molecule 2(CD300E) ELISA kit
E03C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMRF35 like molecule 2(CD300E) ELISA kit
E01C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMRF35 like molecule 2(CD300E) ELISA kit
E01C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMRF35 like molecule 2(CD300E) ELISA kit
E01C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CMRF35 like molecule 2(CD300E) ELISA kit
E07C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CMRF35 like molecule 2(CD300E) ELISA kit
E07C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CMRF35 like molecule 2(CD300E) ELISA kit
E07C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CMRF35 like molecule 2(CD300E) ELISA kit
E09C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CMRF35 like molecule 2(CD300E) ELISA kit
E09C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CMRF35 like molecule 2(CD300E) ELISA kit
E09C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CMRF35 like molecule 2(CD300E) ELISA kit
E08C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CMRF35 like molecule 2(CD300E) ELISA kit
E08C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CMRF35 like molecule 2(CD300E) ELISA kit
E08C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMRF35- like molecule 2, CD300E ELISA KIT
ELI-10372h 96 Tests
EUR 824
Mouse CMRF35- like molecule 2, Cd300e ELISA KIT
ELI-50514m 96 Tests
EUR 865
CD300E Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV654157 1.0 ug DNA
EUR 514
CD300E Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV654161 1.0 ug DNA
EUR 514
CD300E Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV654162 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

CD300e Rabbit Polyclonal Antibody