DYRK2 Rabbit Polyclonal Antibody

DYRK2 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

DYRK2 Polyclonal Antibody

ES10813-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ABP58440-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400

DYRK2 Polyclonal Antibody

ABP58440-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400

DYRK2 Polyclonal Antibody

ABP58440-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400

DYRK2 Polyclonal Antibody

ABP58441-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

ABP58441-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

ABP58441-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

42670-100ul 100ul
EUR 333

DYRK2 Rabbit pAb

A7012-100ul 100 ul
EUR 308

DYRK2 Rabbit pAb

A7012-200ul 200 ul
EUR 459

DYRK2 Rabbit pAb

A7012-20ul 20 ul
EUR 183

DYRK2 Rabbit pAb

A7012-50ul 50 ul
EUR 223

DYRK2 Polyclonal Conjugated Antibody

C42670 100ul
EUR 397

DYRK2 Antibody

ABD10136 100 ug
EUR 438

DYRK2 Antibody

25289-100ul 100ul
EUR 390

DYRK2 Antibody

DF10136 200ul
EUR 304
Description: DYRK2 Antibody detects endogenous levels of total DYRK2.

DYRK2 Antibody

1-CSB-PA852896ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DYRK2. Recognizes DYRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal DYRK2 Antibody (C-Terminus)

AMM06986G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal DYRK2 Antibody (N-term)

APR14269G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal DYRK2 antibody - C-terminal region

AMM06987G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Dyrk2 Antibody (C-term)

APR17418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Dyrk2 (C-term). This antibody is tested and proven to work in the following applications:

DYRK2/4 Antibody

DF10330 200ul
EUR 304
Description: DYRK2/4 Antibody detects endogenous levels of DYRK2/4.

Anti-DYRK2 antibody

STJ29092 100 µl
EUR 277
Description: DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert.

Anti-DYRK2 Antibody

STJ500807 100 µg
EUR 476

Anti-DYRK2 antibody

STJ190110 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2

Anti-DYRK2 antibody

STJ191971 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2

DYRK2 siRNA

20-abx914829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK2 siRNA

20-abx914830
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-DYRK2 Antibody (Biotin)

STJ500808 100 µg
EUR 586

Anti-DYRK2 Antibody (FITC)

STJ500809 100 µg
EUR 586

DYRK2/4 (Phospho-Tyr386/268) Polyclonal Conjugated Antibody

C12498 100ul
EUR 397

DYRK2 Blocking Peptide

DF10136-BP 1mg
EUR 195

DYRK2 cloning plasmid

CSB-CL852896HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgaatgatcacctgcatgtcggcagccacgctcacggacagatccaggttcaacagttgtttgaggataacagtaacaagcggacagtgctcacgacacaaccaaatgggcttacaacagtgggcaaaacgggcttgccagtggtgccagagcggcagctggacagcattcata
  • Show more
Description: A cloning plasmid for the DYRK2 gene.

DYRK2 cloning plasmid

CSB-CL852896HU2-10ug 10ug
EUR 615
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1806
  • Sequence: atgttaaccaggaaaccttcggccgccgctcccgccgcctacccgaccggccgaggtggggacagcgccgttcgtcagcttcaggcttccccggggctcggtgcaggggccacccggagcggagtggggactggcccgccctcccccatcgccctgccgcctctccgggccagca
  • Show more
Description: A cloning plasmid for the DYRK2 gene.

pCDNA3.1-Dyrk2-m

PVT14259 2 ug
EUR 599

Anti-DYRK2 (3G5)

YF-MA16355 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (6E2)

YF-MA16356 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (4G11)

YF-MA16357 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (2F9)

YF-MA16358 200 ul
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (2F9)

YF-MA11064 50 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Monoclonal DYRK2 Antibody, Clone: 492CT4.2.4

AMM06985G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human DYRK2. The antibodies are raised in Mouse and are from clone 492CT4.2.4. This antibody is applicable in WB, E

DYRK2 / 4 (pY386 / 268) Antibody

abx149950-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Mouse DYRK2 shRNA Plasmid

20-abx976876
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken DYRK2 ELISA KIT

ELI-09351c 96 Tests
EUR 928

Human DYRK2 ELISA KIT

ELI-31566h 96 Tests
EUR 824

Mouse Dyrk2 ELISA KIT

ELI-48130m 96 Tests
EUR 865

Human DYRK2 shRNA Plasmid

20-abx955533
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYRK2/4 Blocking Peptide

DF10330-BP 1mg
EUR 195

pCMV-HA-DYRK2 Plasmid

PVTB00719-2a 2 ug
EUR 356

Phospho-DYRK2/4 (Tyr386/268) Antibody

AF8142 200ul
EUR 376
Description: DYRK2/4 (Phospho-Tyr386/268) Antibody detects endogenous levels of DYRK2/4 only when phosphorylated at Tyr386/268.

DYRK2/4 (Phospho- Tyr386/268) Antibody

ABF8142 100 ug
EUR 438

DYRK2/4 (Phospho-Tyr386/268) Antibody

12498-100ul 100ul
EUR 252

DYRK2/4 (Phospho-Tyr386/268) Antibody

12498-50ul 50ul
EUR 187

DYRK2 ORF Vector (Human) (pORF)

ORF003350 1.0 ug DNA
EUR 95

DYRK2 ORF Vector (Human) (pORF)

ORF003351 1.0 ug DNA
EUR 95

Dyrk2 ORF Vector (Rat) (pORF)

ORF066306 1.0 ug DNA
EUR 506

h DYRK2 inducible lentiviral particles

LVP152 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DYRK2, is fully sequence verified and matched to NCBI accession ID: NM_003583

Dyrk2 ORF Vector (Mouse) (pORF)

ORF043492 1.0 ug DNA
EUR 506

pECMV-Dyrk2-m-Myc-FLAG

PVT14273 2 ug
EUR 599

DYRK2 sgRNA CRISPR Lentivector set (Human)

K0645201 3 x 1.0 ug
EUR 339

Dyrk2 sgRNA CRISPR Lentivector set (Mouse)

K3457601 3 x 1.0 ug
EUR 339

Dyrk2 sgRNA CRISPR Lentivector set (Rat)

K6229301 3 x 1.0 ug
EUR 339

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx122510-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx033457-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx033457-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx025430-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx025430-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

20-abx005313
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

20-abx320190
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-DYRK2/4 (Tyr386/268) Blocking Peptide

AF8142-BP 1mg
EUR 195

DYRK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0645202 1.0 ug DNA
EUR 154

DYRK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0645203 1.0 ug DNA
EUR 154

DYRK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0645204 1.0 ug DNA
EUR 154

Dyrk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3457602 1.0 ug DNA
EUR 154

Dyrk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3457603 1.0 ug DNA
EUR 154

Dyrk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3457604 1.0 ug DNA
EUR 154

Dyrk2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6229302 1.0 ug DNA
EUR 154

Dyrk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6229303 1.0 ug DNA
EUR 154

Dyrk2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6229304 1.0 ug DNA
EUR 154

DYRK2 Protein Vector (Mouse) (pPB-C-His)

PV173966 500 ng
EUR 603

DYRK2 Protein Vector (Mouse) (pPB-N-His)

PV173967 500 ng
EUR 603

DYRK2 Protein Vector (Mouse) (pPM-C-HA)

PV173968 500 ng
EUR 603

DYRK2 Protein Vector (Mouse) (pPM-C-His)

PV173969 500 ng
EUR 603

DYRK2 Protein Vector (Human) (pPB-C-His)

PV013397 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPB-N-His)

PV013398 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPM-C-HA)

PV013399 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPM-C-His)

PV013400 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPB-C-His)

PV013401 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPB-N-His)

PV013402 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPM-C-HA)

PV013403 500 ng
EUR 329

DYRK2 Protein Vector (Human) (pPM-C-His)

PV013404 500 ng
EUR 329

DYRK2 Protein Vector (Rat) (pPB-C-His)

PV265222 500 ng
EUR 603

DYRK2 Protein Vector (Rat) (pPB-N-His)

PV265223 500 ng
EUR 603

DYRK2 Protein Vector (Rat) (pPM-C-HA)

PV265224 500 ng
EUR 603

DYRK2 Protein Vector (Rat) (pPM-C-His)

PV265225 500 ng
EUR 603

Dyrk2 3'UTR Luciferase Stable Cell Line

TU203725 1.0 ml Ask for price

Dyrk2 3'UTR GFP Stable Cell Line

TU155498 1.0 ml Ask for price

DYRK2 3'UTR Luciferase Stable Cell Line

TU006473 1.0 ml
EUR 4617

Dyrk2 3'UTR Luciferase Stable Cell Line

TU105498 1.0 ml Ask for price

DYRK2 3'UTR GFP Stable Cell Line

TU056473 1.0 ml
EUR 4617

Dyrk2 3'UTR GFP Stable Cell Line

TU253725 1.0 ml Ask for price

DYRK2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709551 1.0 ug DNA
EUR 316

DYRK2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709555 1.0 ug DNA
EUR 316

DYRK2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709556 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

DYRK2 Rabbit Polyclonal Antibody