LRP6 Rabbit Polyclonal Antibody

LRP6 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

LRP6 Polyclonal Antibody
ABP59148-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500 Applications tips:
Description: A polyclonal antibody for detection of LRP6 from Human, Mouse. This LRP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500

LRP6 Polyclonal Antibody
42243-100ul	SAB	100ul	EUR 333

LRP6 Rabbit pAb
A13324-100ul	Abclonal	100 ul	EUR 308

LRP6 Rabbit pAb
A13324-200ul	Abclonal	200 ul	EUR 459

LRP6 Rabbit pAb
A13324-20ul	Abclonal	20 ul	EUR 183

LRP6 Rabbit pAb
A13324-50ul	Abclonal	50 ul	EUR 223

LRP6 Rabbit pAb
A13678-100ul	Abclonal	100 ul	EUR 308

LRP6 Rabbit pAb
A13678-200ul	Abclonal	200 ul	EUR 459

LRP6 Rabbit pAb
A13678-20ul	Abclonal	20 ul	EUR 183

LRP6 Rabbit pAb
A13678-50ul	Abclonal	50 ul	EUR 223

LRP6 Rabbit pAb
A15070-100ul	Abclonal	100 ul	EUR 308

LRP6 Rabbit pAb
A15070-200ul	Abclonal	200 ul	EUR 459

LRP6 Rabbit pAb
A15070-20ul	Abclonal	20 ul	EUR 183

LRP6 Rabbit pAb
A15070-50ul	Abclonal	50 ul	EUR 223

Polyclonal LRP6 Antibody (Internal)
APS00034G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (Internal). This antibody is tested and proven to work in the following applications:

Rabbit Anti-LRP6 Monoclonal Antibody
CAB-3806RH	Creative Diagnostics	100 ul	EUR 840

Rabbit LRP6 ELISA Kit
ERTL0286	Abclonal	96Tests	EUR 521

LRP6 Antibody
ABD2995	Lifescience Market	100 ug	EUR 438

LRP6 Antibody
ABD7837	Lifescience Market	100 ug	EUR 438

LRP6 Antibody
ABD7954	Lifescience Market	100 ug	EUR 438

LRP6 Antibody
ABD8165	Lifescience Market	100 ug	EUR 438

LRP6 antibody
38724-100ul	SAB	100ul	EUR 252

LRP6 Antibody
43398-100ul	SAB	100ul	EUR 252

LRP6 Antibody
45043-100ul	SAB	100ul	EUR 252

LRP6 Antibody
45043-50ul	SAB	50ul	EUR 187

LRP6 Antibody
DF7837	Affbiotech	200ul	EUR 304
Description: LRP6 Antibody detects endogenous levels of total LRP6.

LRP6 Antibody
DF2995	Affbiotech	200ul	EUR 304
Description: LRP6 Antibody detects endogenous levels of total LRP6.

LRP6 Antibody
1-CSB-PA013102ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LRP6 Antibody
1-CSB-PA234397	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:40-1:200

Polyclonal LRP6 Antibody (internal region)
APS00033G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (internal region). This antibody is tested and proven to work in the following applications:

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
DLR-LRP6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids.

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
DLR-LRP6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids.

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
RD-LRP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
RD-LRP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
RDR-LRP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
RDR-LRP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Polyclonal LRP6 Antibody (C-term T1546)
APR14063G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP6 (C-term T1546). This antibody is tested and proven to work in the following applications:

LRP6 (Phospho-Thr1479) Polyclonal Conjugated Antibody
C12661	SAB	100ul	EUR 397

LRP6 (Phospho-Ser1490) Polyclonal Conjugated Antibody
C12809	SAB	100ul	EUR 397

LRP6 Conjugated Antibody
C38724	SAB	100ul	EUR 397

LRP6 Conjugated Antibody
C45043	SAB	100ul	EUR 397

LRP6 (pT1479) Antibody
abx216611-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

LRP6 (pS1490) Antibody
20-abx216612	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-LRP6 antibody
STJ70616	St John's Laboratory	100 µg	EUR 359

Anti-LRP6 antibody
STJ27887	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody
STJ115287	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody
STJ115288	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody
STJ117264	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody
STJ190146	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LRP6

Anti-LRP6 antibody
STJ115633	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

LRP6 siRNA
20-abx922854	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LRP6 siRNA
20-abx922855	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Phospho-LRP6 (Thr1479) Antibody
AF8343	Affbiotech	200ul	EUR 376
Description: LRP6 (Phospho-Thr1479) Antibody detects endogenous levels of LRP6 only when phosphorylated at Thr1479.

Phospho-LRP6 (Ser1490) Antibody
AF8344	Affbiotech	200ul	EUR 376
Description: LRP6 (Phospho-Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490.

LRP6 (Phospho- Thr1479) Antibody
ABF8343	Lifescience Market	100 ug	EUR 438

LRP6 (Phospho- Ser1490) Antibody
ABF8344	Lifescience Market	100 ug	EUR 438

Phospho-LRP6 (Ser1490) Antibody
abx216613-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Phospho- LRP6 (Ser1490) Antibody
ABD2994	Lifescience Market	100 ug	EUR 438

LRP6 (Phospho-Thr1479) Antibody
12661-100ul	SAB	100ul	EUR 252

LRP6 (Phospho-Thr1479) Antibody
12661-50ul	SAB	50ul	EUR 187

LRP6 (Phospho-Ser1490) Antibody
12809-100ul	SAB	100ul	EUR 252

LRP6 (Phospho-Ser1490) Antibody
12809-50ul	SAB	50ul	EUR 187

Phospho-LRP6 (Ser1490) Antibody
DF2994	Affbiotech	200ul	EUR 304
Description: Phospho-LRP6 (Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490.

LRP6 cloning plasmid
CSB-CL013102HU-10ug	Cusabio	10ug	EUR 1882
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4842 Sequence: atgggggccgtcctgaggagcctcctggcctgcagcttctgtgtgctcctgagagcggcccctttgttgctttatgcaaacagacgggacttgcgattggttgatgctacaaatggcaaagagaatgctacgattgtagttggaggcttggaggatgcagctgcggtggactttg Show more
Description: A cloning plasmid for the LRP6 gene.

LRP6 Blocking Peptide
DF7837-BP	Affbiotech	1mg	EUR 195

LRP6 Blocking Peptide
DF2995-BP	Affbiotech	1mg	EUR 195

Low-density lipoprotein receptor-related protein 6 (LRP6) polyclonal antibody
ABP-PAB-10779	Allele Biotech	100 ug	Ask for price
Product line: Cell Surface Molecules / GPCRs Brand:

Anti-Human LRP6 Antibody, phospho S149
CABT-28228RH	Creative Diagnostics	100 ul	EUR 710

Human LRP6 ELISA Kit
EHL0286	Abclonal	96Tests	EUR 521

Human LRP6 ELISA Kit
ELA-E1010h	Lifescience Market	96 Tests	EUR 824

Goat LRP6 ELISA Kit
EGTL0286	Abclonal	96Tests	EUR 521

Bovine LRP6 ELISA Kit
EBL0286	Abclonal	96Tests	EUR 521

Chicken LRP6 ELISA Kit
ECKL0286	Abclonal	96Tests	EUR 521

Canine LRP6 ELISA Kit
ECL0286	Abclonal	96Tests	EUR 521

Anserini LRP6 ELISA Kit
EAL0286	Abclonal	96Tests	EUR 521

Human LRP6 ELISA KIT
ELI-03231h	Lifescience Market	96 Tests	EUR 824

Mouse Lrp6 ELISA KIT
ELI-03232m	Lifescience Market	96 Tests	EUR 865

LRP6 ELISA KIT|Human
EF001894	Lifescience Market	96 Tests	EUR 689

Porcine LRP6 ELISA Kit
EPL0286	Abclonal	96Tests	EUR 521

Rat LRP6 ELISA Kit
ERL0286	Abclonal	96Tests	EUR 521

Sheep LRP6 ELISA Kit
ESL0286	Abclonal	96Tests	EUR 521

Monkey LRP6 ELISA Kit
EMKL0286	Abclonal	96Tests	EUR 521

Mouse LRP6 ELISA Kit
EML0286	Abclonal	96Tests	EUR 521

Human LRP6 shRNA Plasmid
20-abx952731	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LRP6 shRNA Plasmid
20-abx971354	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human)
4-PAD105Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6)

Monoclonal LRP6 Antibody Phospho (pS1490), Clone: EP2360Y
APR12456G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human LRP6 Phospho (pS1490). The antibodies are raised in Rabbit and are from clone EP2360Y. This antibody is applicable in WB

Phospho-LRP6 (Thr1479) Blocking Peptide
AF8343-BP	Affbiotech	1mg	EUR 195

Phospho-LRP6 (Ser1490) Blocking Peptide
AF8344-BP	Affbiotech	1mg	EUR 195

Guinea Pig LRP6 ELISA Kit
EGL0286	Abclonal	96Tests	EUR 521

Phospho-LRP6 (Ser1490) Blocking Peptide
DF2994-BP	Affbiotech	1mg	EUR 195

Lrp6 ORF Vector (Mouse) (pORF)
ORF049377	ABM	1.0 ug DNA	EUR 1572

LRP6 ORF Vector (Human) (pORF)
ORF013703	ABM	1.0 ug DNA	EUR 354

Lrp6 ORF Vector (Rat) (pORF)
ORF069981	ABM	1.0 ug DNA	EUR 506

pCMV-C-HA-LRP6 Plasmid
PVTB00515-2a	Lifescience Market	2 ug	EUR 356

pCR-XL-TOPO-LRP6 Plasmid
PVT17087	Lifescience Market	2 ug	EUR 325

LRP6 ELISA Kit (Human) (OKCD08388)
OKCD08388	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

LRP6 ELISA Kit (Mouse) (OKEH03262)
OKEH03262	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Component of the Wnt-Fzd-LRP5-LRP6 complex that triggers beta-catenin signaling through inducing aggregation of receptor-ligand complexes into ribosome-sized signalsomes. Cell-surface coreceptor of Wnt/beta-catenin signaling, which plays a pivotal role in bone formation. The Wnt-induced Fzd/LRP6 coreceptor complex recruits DVL1 polymers to the plasma membrane which, in turn, recruits the AXIN1/GSK3B-complex to the cell surface promoting the formation of signalsomes and inhibiting AXIN1/GSK3-mediated phosphorylation and destruction of beta-catenin. Required for posterior patterning of the epiblast during gastrulation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL

LRP6 ELISA Kit (Human) (OKEH04408)
OKEH04408	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), APC
4-PAD105Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with APC.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), Biotinylated
4-PAD105Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with Biotin.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), Cy3
4-PAD105Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with Cy3.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), FITC
4-PAD105Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with FITC.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), HRP
4-PAD105Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with HRP.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), PE
4-PAD105Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with PE.

Rabbit Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit
abx362877-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), APC-Cy7
4-PAD105Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LRP6 (Trp981~Gly1213) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with APC-Cy7.

LRP6 sgRNA CRISPR Lentivector set (Human)
K1230601	ABM	3 x 1.0 ug	EUR 339

Lrp6 sgRNA CRISPR Lentivector set (Mouse)
K4359301	ABM	3 x 1.0 ug	EUR 339

Lrp6 sgRNA CRISPR Lentivector set (Rat)
K6746101	ABM	3 x 1.0 ug	EUR 339

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx000776	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx147049	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx104536	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
abx032705-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
abx032705-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx004691	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx173389	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx320247	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
abx431397-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody
20-abx212450	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

LRP6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1230602	ABM	1.0 ug DNA	EUR 154

LRP6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1230603	ABM	1.0 ug DNA	EUR 154

LRP6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1230604	ABM	1.0 ug DNA	EUR 154

Lrp6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4359302	ABM	1.0 ug DNA	EUR 154

Lrp6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4359303	ABM	1.0 ug DNA	EUR 154

Lrp6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4359304	ABM	1.0 ug DNA	EUR 154

Lrp6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6746102	ABM	1.0 ug DNA	EUR 154

Lrp6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6746103	ABM	1.0 ug DNA	EUR 154

Lrp6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6746104	ABM	1.0 ug DNA	EUR 154

LRP6 Protein Vector (Human) (pPB-C-His)
PV054809	ABM	500 ng	EUR 481

LRP6 Protein Vector (Human) (pPB-N-His)
PV054810	ABM	500 ng	EUR 481

LRP6 Protein Vector (Human) (pPM-C-HA)
PV054811	ABM	500 ng	EUR 481

LRP6 Protein Vector (Human) (pPM-C-His)
PV054812	ABM	500 ng	EUR 481

LRP6 Protein Vector (Rat) (pPB-C-His)
PV279922	ABM	500 ng	EUR 1191

LRP6 Protein Vector (Rat) (pPB-N-His)
PV279923	ABM	500 ng	EUR 1191

LRP6 Protein Vector (Rat) (pPM-C-HA)
PV279924	ABM	500 ng	EUR 1191

LRP6 Protein Vector (Rat) (pPM-C-His)
PV279925	ABM	500 ng	EUR 1191

LRP6 Protein Vector (Mouse) (pPB-C-His)
PV197506	ABM	500 ng	EUR 2710

LRP6 Protein Vector (Mouse) (pPB-N-His)
PV197507	ABM	500 ng	EUR 2710

LRP6 Protein Vector (Mouse) (pPM-C-HA)
PV197508	ABM	500 ng	EUR 2710

LRP6 Protein Vector (Mouse) (pPM-C-His)
PV197509	ABM	500 ng	EUR 2710

Lrp6 3'UTR GFP Stable Cell Line
TU162581	ABM	1.0 ml	Ask for price

Lrp6 3'UTR Luciferase Stable Cell Line
TU212542	ABM	1.0 ml	Ask for price

LRP6 3'UTR Luciferase Stable Cell Line
TU012621	ABM	1.0 ml	EUR 4617

Lrp6 3'UTR Luciferase Stable Cell Line
TU112581	ABM	1.0 ml	Ask for price

LRP6 3'UTR GFP Stable Cell Line
TU062621	ABM	1.0 ml	EUR 4617

Lrp6 3'UTR GFP Stable Cell Line
TU262542	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LRP6 Rabbit Polyclonal Antibody