LRP6 Rabbit Polyclonal Antibody

LRP6 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

LRP6 Polyclonal Antibody

ABP59148-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500
  • Applications tips:
Description: A polyclonal antibody for detection of LRP6 from Human, Mouse. This LRP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500

LRP6 Polyclonal Antibody

42243-100ul 100ul
EUR 333

LRP6 Rabbit pAb

A13324-100ul 100 ul
EUR 308

LRP6 Rabbit pAb

A13324-200ul 200 ul
EUR 459

LRP6 Rabbit pAb

A13324-20ul 20 ul
EUR 183

LRP6 Rabbit pAb

A13324-50ul 50 ul
EUR 223

LRP6 Rabbit pAb

A13678-100ul 100 ul
EUR 308

LRP6 Rabbit pAb

A13678-200ul 200 ul
EUR 459

LRP6 Rabbit pAb

A13678-20ul 20 ul
EUR 183

LRP6 Rabbit pAb

A13678-50ul 50 ul
EUR 223

LRP6 Rabbit pAb

A15070-100ul 100 ul
EUR 308

LRP6 Rabbit pAb

A15070-200ul 200 ul
EUR 459

LRP6 Rabbit pAb

A15070-20ul 20 ul
EUR 183

LRP6 Rabbit pAb

A15070-50ul 50 ul
EUR 223

Polyclonal LRP6 Antibody (Internal)

APS00034G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (Internal). This antibody is tested and proven to work in the following applications:

Rabbit Anti-LRP6 Monoclonal Antibody

CAB-3806RH 100 ul
EUR 840

Rabbit LRP6 ELISA Kit

ERTL0286 96Tests
EUR 521

LRP6 Antibody

ABD2995 100 ug
EUR 438

LRP6 Antibody

ABD7837 100 ug
EUR 438

LRP6 Antibody

ABD7954 100 ug
EUR 438

LRP6 Antibody

ABD8165 100 ug
EUR 438

LRP6 antibody

38724-100ul 100ul
EUR 252

LRP6 Antibody

43398-100ul 100ul
EUR 252

LRP6 Antibody

45043-100ul 100ul
EUR 252

LRP6 Antibody

45043-50ul 50ul
EUR 187

LRP6 Antibody

DF7837 200ul
EUR 304
Description: LRP6 Antibody detects endogenous levels of total LRP6.

LRP6 Antibody

DF2995 200ul
EUR 304
Description: LRP6 Antibody detects endogenous levels of total LRP6.

LRP6 Antibody

1-CSB-PA013102ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LRP6 Antibody

1-CSB-PA234397
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:40-1:200

Polyclonal LRP6 Antibody (internal region)

APS00033G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (internal region). This antibody is tested and proven to work in the following applications:

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

DLR-LRP6-Hu-48T 48T
EUR 517
  • Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids.

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

DLR-LRP6-Hu-96T 96T
EUR 673
  • Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids.

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RD-LRP6-Hu-48Tests 48 Tests
EUR 521

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RD-LRP6-Hu-96Tests 96 Tests
EUR 723

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RDR-LRP6-Hu-48Tests 48 Tests
EUR 544

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RDR-LRP6-Hu-96Tests 96 Tests
EUR 756

Polyclonal LRP6 Antibody (C-term T1546)

APR14063G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP6 (C-term T1546). This antibody is tested and proven to work in the following applications:

LRP6 (Phospho-Thr1479) Polyclonal Conjugated Antibody

C12661 100ul
EUR 397

LRP6 (Phospho-Ser1490) Polyclonal Conjugated Antibody

C12809 100ul
EUR 397

LRP6 Conjugated Antibody

C38724 100ul
EUR 397

LRP6 Conjugated Antibody

C45043 100ul
EUR 397

LRP6 (pT1479) Antibody

abx216611-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

LRP6 (pS1490) Antibody

20-abx216612
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LRP6 antibody

STJ70616 100 µg
EUR 359

Anti-LRP6 antibody

STJ27887 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ115287 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ115288 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ117264 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ190146 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRP6

Anti-LRP6 antibody

STJ115633 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

LRP6 siRNA

20-abx922854
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRP6 siRNA

20-abx922855
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-LRP6 (Thr1479) Antibody

AF8343 200ul
EUR 376
Description: LRP6 (Phospho-Thr1479) Antibody detects endogenous levels of LRP6 only when phosphorylated at Thr1479.

Phospho-LRP6 (Ser1490) Antibody

AF8344 200ul
EUR 376
Description: LRP6 (Phospho-Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490.

LRP6 (Phospho- Thr1479) Antibody

ABF8343 100 ug
EUR 438

LRP6 (Phospho- Ser1490) Antibody

ABF8344 100 ug
EUR 438

Phospho-LRP6 (Ser1490) Antibody

abx216613-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Phospho- LRP6 (Ser1490) Antibody

ABD2994 100 ug
EUR 438

LRP6 (Phospho-Thr1479) Antibody

12661-100ul 100ul
EUR 252

LRP6 (Phospho-Thr1479) Antibody

12661-50ul 50ul
EUR 187

LRP6 (Phospho-Ser1490) Antibody

12809-100ul 100ul
EUR 252

LRP6 (Phospho-Ser1490) Antibody

12809-50ul 50ul
EUR 187

Phospho-LRP6 (Ser1490) Antibody

DF2994 200ul
EUR 304
Description: Phospho-LRP6 (Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490.

LRP6 cloning plasmid

CSB-CL013102HU-10ug 10ug
EUR 1882
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4842
  • Sequence: atgggggccgtcctgaggagcctcctggcctgcagcttctgtgtgctcctgagagcggcccctttgttgctttatgcaaacagacgggacttgcgattggttgatgctacaaatggcaaagagaatgctacgattgtagttggaggcttggaggatgcagctgcggtggactttg
  • Show more
Description: A cloning plasmid for the LRP6 gene.

LRP6 Blocking Peptide

DF7837-BP 1mg
EUR 195

LRP6 Blocking Peptide

DF2995-BP 1mg
EUR 195

Low-density lipoprotein receptor-related protein 6 (LRP6) polyclonal antibody

ABP-PAB-10779 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:

Anti-Human LRP6 Antibody, phospho S149

CABT-28228RH 100 ul
EUR 710

Human LRP6 ELISA Kit

EHL0286 96Tests
EUR 521

Human LRP6 ELISA Kit

ELA-E1010h 96 Tests
EUR 824

Goat LRP6 ELISA Kit

EGTL0286 96Tests
EUR 521

Bovine LRP6 ELISA Kit

EBL0286 96Tests
EUR 521

Chicken LRP6 ELISA Kit

ECKL0286 96Tests
EUR 521

Canine LRP6 ELISA Kit

ECL0286 96Tests
EUR 521

Anserini LRP6 ELISA Kit

EAL0286 96Tests
EUR 521

Human LRP6 ELISA KIT

ELI-03231h 96 Tests
EUR 824

Mouse Lrp6 ELISA KIT

ELI-03232m 96 Tests
EUR 865

LRP6 ELISA KIT|Human

EF001894 96 Tests
EUR 689

Porcine LRP6 ELISA Kit

EPL0286 96Tests
EUR 521

Rat LRP6 ELISA Kit

ERL0286 96Tests
EUR 521

Sheep LRP6 ELISA Kit

ESL0286 96Tests
EUR 521

Monkey LRP6 ELISA Kit

EMKL0286 96Tests
EUR 521

Mouse LRP6 ELISA Kit

EML0286 96Tests
EUR 521

Human LRP6 shRNA Plasmid

20-abx952731
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LRP6 shRNA Plasmid

20-abx971354
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human)

4-PAD105Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6)

Monoclonal LRP6 Antibody Phospho (pS1490), Clone: EP2360Y

APR12456G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human LRP6 Phospho (pS1490). The antibodies are raised in Rabbit and are from clone EP2360Y. This antibody is applicable in WB

Phospho-LRP6 (Thr1479) Blocking Peptide

AF8343-BP 1mg
EUR 195

Phospho-LRP6 (Ser1490) Blocking Peptide

AF8344-BP 1mg
EUR 195

Guinea Pig LRP6 ELISA Kit

EGL0286 96Tests
EUR 521

Phospho-LRP6 (Ser1490) Blocking Peptide

DF2994-BP 1mg
EUR 195

Lrp6 ORF Vector (Mouse) (pORF)

ORF049377 1.0 ug DNA
EUR 1572

LRP6 ORF Vector (Human) (pORF)

ORF013703 1.0 ug DNA
EUR 354

Lrp6 ORF Vector (Rat) (pORF)

ORF069981 1.0 ug DNA
EUR 506

pCMV-C-HA-LRP6 Plasmid

PVTB00515-2a 2 ug
EUR 356

pCR-XL-TOPO-LRP6 Plasmid

PVT17087 2 ug
EUR 325

LRP6 ELISA Kit (Human) (OKCD08388)

OKCD08388 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

LRP6 ELISA Kit (Mouse) (OKEH03262)

OKEH03262 96 Wells
EUR 662
Description: Description of target: Component of the Wnt-Fzd-LRP5-LRP6 complex that triggers beta-catenin signaling through inducing aggregation of receptor-ligand complexes into ribosome-sized signalsomes. Cell-surface coreceptor of Wnt/beta-catenin signaling, which plays a pivotal role in bone formation. The Wnt-induced Fzd/LRP6 coreceptor complex recruits DVL1 polymers to the plasma membrane which, in turn, recruits the AXIN1/GSK3B-complex to the cell surface promoting the formation of signalsomes and inhibiting AXIN1/GSK3-mediated phosphorylation and destruction of beta-catenin. Required for posterior patterning of the epiblast during gastrulation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL

LRP6 ELISA Kit (Human) (OKEH04408)

OKEH04408 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), APC

4-PAD105Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with APC.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), Biotinylated

4-PAD105Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with Biotin.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), Cy3

4-PAD105Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with Cy3.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), FITC

4-PAD105Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with FITC.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), HRP

4-PAD105Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with HRP.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), PE

4-PAD105Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with PE.

Rabbit Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

abx362877-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Polyclonal Antibody (Human), APC-Cy7

4-PAD105Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRP6 (Trp981~Gly1213)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6). This antibody is labeled with APC-Cy7.

LRP6 sgRNA CRISPR Lentivector set (Human)

K1230601 3 x 1.0 ug
EUR 339

Lrp6 sgRNA CRISPR Lentivector set (Mouse)

K4359301 3 x 1.0 ug
EUR 339

Lrp6 sgRNA CRISPR Lentivector set (Rat)

K6746101 3 x 1.0 ug
EUR 339

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx000776
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx147049
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx104536
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

abx032705-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

abx032705-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx004691
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx173389
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx320247
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

abx431397-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Low Density Lipoprotein Receptor Related Protein 6 (LRP6) Antibody

20-abx212450
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LRP6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1230602 1.0 ug DNA
EUR 154

LRP6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1230603 1.0 ug DNA
EUR 154

LRP6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1230604 1.0 ug DNA
EUR 154

Lrp6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4359302 1.0 ug DNA
EUR 154

Lrp6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4359303 1.0 ug DNA
EUR 154

Lrp6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4359304 1.0 ug DNA
EUR 154

Lrp6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6746102 1.0 ug DNA
EUR 154

Lrp6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6746103 1.0 ug DNA
EUR 154

Lrp6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6746104 1.0 ug DNA
EUR 154

LRP6 Protein Vector (Human) (pPB-C-His)

PV054809 500 ng
EUR 481

LRP6 Protein Vector (Human) (pPB-N-His)

PV054810 500 ng
EUR 481

LRP6 Protein Vector (Human) (pPM-C-HA)

PV054811 500 ng
EUR 481

LRP6 Protein Vector (Human) (pPM-C-His)

PV054812 500 ng
EUR 481

LRP6 Protein Vector (Rat) (pPB-C-His)

PV279922 500 ng
EUR 1191

LRP6 Protein Vector (Rat) (pPB-N-His)

PV279923 500 ng
EUR 1191

LRP6 Protein Vector (Rat) (pPM-C-HA)

PV279924 500 ng
EUR 1191

LRP6 Protein Vector (Rat) (pPM-C-His)

PV279925 500 ng
EUR 1191

LRP6 Protein Vector (Mouse) (pPB-C-His)

PV197506 500 ng
EUR 2710

LRP6 Protein Vector (Mouse) (pPB-N-His)

PV197507 500 ng
EUR 2710

LRP6 Protein Vector (Mouse) (pPM-C-HA)

PV197508 500 ng
EUR 2710

LRP6 Protein Vector (Mouse) (pPM-C-His)

PV197509 500 ng
EUR 2710

Lrp6 3'UTR GFP Stable Cell Line

TU162581 1.0 ml Ask for price

Lrp6 3'UTR Luciferase Stable Cell Line

TU212542 1.0 ml Ask for price

LRP6 3'UTR Luciferase Stable Cell Line

TU012621 1.0 ml
EUR 4617

Lrp6 3'UTR Luciferase Stable Cell Line

TU112581 1.0 ml Ask for price

LRP6 3'UTR GFP Stable Cell Line

TU062621 1.0 ml
EUR 4617

Lrp6 3'UTR GFP Stable Cell Line

TU262542 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LRP6 Rabbit Polyclonal Antibody