PDE3A Rabbit Polyclonal Antibody

PDE3A Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

PDE3A Polyclonal Antibody

ABP59862-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of PDE3A from Human, Mouse, Rat. This PDE3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330

PDE3A Polyclonal Antibody

ABP59862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of PDE3A from Human, Mouse, Rat. This PDE3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330

PDE3A Polyclonal Antibody

ES9007-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PDE3A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDE3A Polyclonal Antibody

ES9007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PDE3A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDE3A Rabbit pAb

A17919-100ul 100 ul
EUR 308

PDE3A Rabbit pAb

A17919-200ul 200 ul
EUR 459

PDE3A Rabbit pAb

A17919-20ul 20 ul
EUR 183

PDE3A Rabbit pAb

A17919-50ul 50 ul
EUR 223

PDE3A Polyclonal Conjugated Antibody

C30227 100ul
EUR 397

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Mu-48T 48T
EUR 527
  • Should the Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Mu-96T 96T
EUR 688
  • Should the Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Ra-48T 48T
EUR 549
  • Should the Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Ra-96T 96T
EUR 718
  • Should the Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Hu-48T 48T
EUR 517
  • Should the Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Hu-96T 96T
EUR 673
  • Should the Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Hu-48Tests 48 Tests
EUR 544

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Hu-96Tests 96 Tests
EUR 756

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Mu-48Tests 48 Tests
EUR 557

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Mu-96Tests 96 Tests
EUR 774

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Ra-48Tests 48 Tests
EUR 583

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Ra-96Tests 96 Tests
EUR 811

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Hu-48Tests 48 Tests
EUR 521

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Hu-96Tests 96 Tests
EUR 723

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Mu-48Tests 48 Tests
EUR 533

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Mu-96Tests 96 Tests
EUR 740

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Ra-48Tests 48 Tests
EUR 557

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Ra-96Tests 96 Tests
EUR 775

PDE3A antibody

20R-PR083 50 ug
EUR 656
Description: Rabbit polyclonal PDE3A antibody

PDE3A antibody

20R-PR084 50 ug
EUR 656
Description: Rabbit polyclonal PDE3A antibody

PDE3A antibody

20R-PR090 50 ug
EUR 656
Description: Rabbit polyclonal PDE3A antibody

PDE3A Antibody

39579-100ul 100ul
EUR 390

PDE3A Antibody

DF9371 200ul
EUR 304
Description: PDE3A Antibody detects endogenous levels of total PDE3A.

PDE3A antibody

70R-6279 50 ug
EUR 467
Description: Rabbit polyclonal PDE3A antibody raised against the N terminal of PDE3A

PDE3A Antibody

ABD9371 100 ug
EUR 438

Polyclonal PDE3A Antibody (N-Terminus)

AMM07053G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDE3A (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal PDE3A Antibody (N-Terminus)

AMM07054G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDE3A (N-Terminus). This antibody is tested and proven to work in the following applications:

PDE3A (Phospho-Ser312) Polyclonal Conjugated Antibody

C12773 100ul
EUR 397

PDE3A (pS312) Antibody

abx217677-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PDE3A antibody

STJ119906 100 µl
EUR 277
Description: This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-PDE3A antibody

STJ190165 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDE3A

Anti-PDE3A Antibody

STJ502262 100 µg
EUR 515

Anti-PDE3A Antibody

STJ502263 100 µg
EUR 515

PDE3A siRNA

20-abx903894
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDE3A siRNA

20-abx928071
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDE3A siRNA

20-abx928072
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PDE3A

YF-PA24325 50 ul
EUR 334
Description: Mouse polyclonal to PDE3A

PDE3A (Phospho-Ser312) Antibody

12773-100ul 100ul
EUR 252

PDE3A (Phospho-Ser312) Antibody

12773-50ul 50ul
EUR 187

Phospho-PDE3A (Ser312) Antibody

AF8501 200ul
EUR 376
Description: PDE3A (Phospho-Ser312) Antibody detects endogenous levels of PDE3A only when phosphorylated at Ser312.

PDE3A (Phospho- Ser312) Antibody

ABF8501 100 ug
EUR 438

Anti-PDE3A Antibody (Biotin)

STJ502264 100 µg
EUR 586

Anti-PDE3A Antibody (FITC)

STJ502265 100 µg
EUR 586

Anti-PDE3A Antibody (Biotin)

STJ502266 100 µg
EUR 586

Anti-PDE3A Antibody (FITC)

STJ502267 100 µg
EUR 586

Anti-Phospho-PDE3A Antibody

STJ502603 100 µg
EUR 586

PDE3A Blocking Peptide

33R-5115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDE3A antibody, catalog no. 70R-6279

PDE3A Blocking Peptide

DF9371-BP 1mg
EUR 195

PDE3A cloning plasmid

CSB-CL614528HU-10ug 10ug
EUR 1217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3426
  • Sequence: atggcagtgcccggcgacgctgcacgagtcagggacaagcccgtccacagtggggtgagtcaagcccccacggcgggccgggactgccaccatcgtgcggaccccgcatcgccgcgggactcgggctgccgtggctgctggggagacctggtgctgcagccgctccggagctctc
  • Show more
Description: A cloning plasmid for the PDE3A gene.

Recombinant human PDE3A

P1146 100ug Ask for price
  • Uniprot ID: Q14432
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human PDE3A

pDONR223-PDE3A Plasmid

PVTB01077-1 2 ug
EUR 356

Anti-PDE3A (5C12)

YF-MA14638 100 ug
EUR 363
Description: Mouse monoclonal to PDE3A

Anti-PDE3A (2D7)

YF-MA14639 100 ug
EUR 363
Description: Mouse monoclonal to PDE3A

Anti-Phospho-PDE3A Antibody BIOTIN

STJ502604 100 µg
EUR 645

Anti-Phospho-PDE3A Antibody FITC

STJ502605 100 µg
EUR 645

Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Antibody

20-abx177987
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phosphodiesterase 3A, CGMP Inhibited (PDE3A) Antibody

abx037224-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Antibody

20-abx174024
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mouse PDE3A shRNA Plasmid

20-abx974523
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PDE3A shRNA Plasmid

20-abx985753
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PDE3A shRNA Plasmid

20-abx953419
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal PDE3A Antibody (monoclonal) (M01), Clone: 5C12

AMM07052G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PDE3A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5C12. This antibody is applicable in WB, E

Phospho-PDE3A (Ser312) Blocking Peptide

AF8501-BP 1mg
EUR 195

Pde3a ORF Vector (Rat) (pORF)

ORF073261 1.0 ug DNA
EUR 506

PDE3A ORF Vector (Human) (pORF)

ORF014043 1.0 ug DNA
EUR 95

Pde3a ORF Vector (Mouse) (pORF)

ORF053644 1.0 ug DNA
EUR 506

PDE3A ELISA Kit (Rat) (OKCD01263)

OKCD01263 96 Wells
EUR 896
Description: Description of target: Cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.27 ng/mL.

Pde3a sgRNA CRISPR Lentivector set (Mouse)

K5032501 3 x 1.0 ug
EUR 339

Pde3a sgRNA CRISPR Lentivector set (Rat)

K6880501 3 x 1.0 ug
EUR 339

PDE3A sgRNA CRISPR Lentivector set (Human)

K1617801 3 x 1.0 ug
EUR 339

Recombinant Phosphodiesterase 3A, cGMP Inhibited (PDE3A)

4-RPF639Ra01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62865
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Phosphodiesterase 3A, cGMP Inhibited expressed in: E.coli

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Protein

20-abx650669
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5032502 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5032503 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5032504 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6880502 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6880503 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6880504 1.0 ug DNA
EUR 154

PDE3A sgRNA CRISPR Lentivector (Human) (Target 1)

K1617802 1.0 ug DNA
EUR 154

PDE3A sgRNA CRISPR Lentivector (Human) (Target 2)

K1617803 1.0 ug DNA
EUR 154

PDE3A sgRNA CRISPR Lentivector (Human) (Target 3)

K1617804 1.0 ug DNA
EUR 154

PDE3A Protein Vector (Rat) (pPB-C-His)

PV293042 500 ng
EUR 1166

PDE3A Protein Vector (Rat) (pPB-N-His)

PV293043 500 ng
EUR 1166

PDE3A Protein Vector (Rat) (pPM-C-HA)

PV293044 500 ng
EUR 1166

PDE3A Protein Vector (Rat) (pPM-C-His)

PV293045 500 ng
EUR 1166

PDE3A Protein Vector (Mouse) (pPB-C-His)

PV214574 500 ng
EUR 1065

PDE3A Protein Vector (Mouse) (pPB-N-His)

PV214575 500 ng
EUR 1065

PDE3A Protein Vector (Mouse) (pPM-C-HA)

PV214576 500 ng
EUR 1065

PDE3A Protein Vector (Mouse) (pPM-C-His)

PV214577 500 ng
EUR 1065

PDE3A Protein Vector (Human) (pPB-C-His)

PV056169 500 ng
EUR 481

PDE3A Protein Vector (Human) (pPB-N-His)

PV056170 500 ng
EUR 481

PDE3A Protein Vector (Human) (pPM-C-HA)

PV056171 500 ng
EUR 481

PDE3A Protein Vector (Human) (pPM-C-His)

PV056172 500 ng
EUR 481

Pde3a 3'UTR Luciferase Stable Cell Line

TU116102 1.0 ml Ask for price

Pde3a 3'UTR GFP Stable Cell Line

TU166102 1.0 ml Ask for price

Pde3a 3'UTR Luciferase Stable Cell Line

TU215992 1.0 ml Ask for price

Pde3a 3'UTR GFP Stable Cell Line

TU265992 1.0 ml Ask for price

PDE3A 3'UTR GFP Stable Cell Line

TU067630 1.0 ml
EUR 1394

PDE3A 3'UTR Luciferase Stable Cell Line

TU017630 1.0 ml
EUR 1394

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

20-abx155951
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) CLIA Kit

20-abx494970
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PDE3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV693943 1.0 ug DNA
EUR 1355

PDE3A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV693947 1.0 ug DNA
EUR 1355

PDE3A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV693948 1.0 ug DNA
EUR 1355

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

SEF639Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in Tissue homogenates and other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

SEF639Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in Tissue homogenates and other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

SEF639Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in Tissue homogenates and other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

SEF639Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in Tissue homogenates and other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

4-SEF639Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phosphodiesterase 3A, cGMP Inhibited elisa. Alternative names of the recognized antigen: CGI-PDE
  • Cyclic GMP-inhibited phosphodiesterase A
  • cGMP-inhibited 3', 5'-cyclic phosphodiesterase A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody

ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody

ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

PDE3A Rabbit Polyclonal Antibody