TPPP Rabbit Polyclonal Antibody

TPPP Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

TPPP Polyclonal Antibody
ES8985-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPPP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TPPP Polyclonal Antibody
ABP60742-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
TPPP Polyclonal Antibody
ABP60742-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
TPPP Polyclonal Antibody
ABP60742-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
TPPP Rabbit mAb
A4637-100ul 100 ul
EUR 410
TPPP Rabbit mAb
A4637-200ul 200 ul
EUR 571
TPPP Rabbit mAb
A4637-20ul 20 ul
EUR 221
TPPP Rabbit mAb
A4637-50ul 50 ul
EUR 287
TPPP Rabbit pAb
A8574-100ul 100 ul
EUR 308
TPPP Rabbit pAb
A8574-200ul 200 ul
EUR 459
TPPP Rabbit pAb
A8574-20ul 20 ul
EUR 183
TPPP Rabbit pAb
A8574-50ul 50 ul
EUR 223
Polyclonal TPPP Antibody (Internal)
APR13793G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPPP (Internal). This antibody is tested and proven to work in the following applications:
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Hu-48T 48T
EUR 479
  • Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Hu-96T 96T
EUR 621
  • Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Mu-48T 48T
EUR 489
  • Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Mu-96T 96T
EUR 635
  • Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Hu-48Tests 48 Tests
EUR 500
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Hu-96Tests 96 Tests
EUR 692
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Mu-48Tests 48 Tests
EUR 511
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Mu-96Tests 96 Tests
EUR 709
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Hu-48Tests 48 Tests
EUR 478
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Hu-96Tests 96 Tests
EUR 662
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Mu-48Tests 48 Tests
EUR 489
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Mu-96Tests 96 Tests
EUR 677
Rabbit TPPP ELISA Kit
ERTT0320 96Tests
EUR 521
TPPP antibody
70R-20942 50 ul
EUR 435
Description: Rabbit polyclonal TPPP antibody
TPPP Antibody
ABD7880 100 ug
EUR 438
TPPP Antibody
ABD7919 100 ug
EUR 438
TPPP Antibody
42950-100ul 100ul
EUR 252
TPPP antibody
70R-10328 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TPPP antibody
TPPP Antibody
DF7880 200ul
EUR 304
Description: TPPP Antibody detects endogenous levels of total TPPP.
TPPP Antibody
1-CSB-PA024115ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
TPPP Antibody
1-CSB-PA024115GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal Tppp antibody - C-terminal region
AMM08300G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tppp - C-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal TPPP/p25 Antibody (internal region)
APR13794G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPPP/p25 (internal region). This antibody is tested and proven to work in the following applications:
TPPP (Phospho-Ser18) Polyclonal Conjugated Antibody
C12649 100ul
EUR 397
TPPP Conjugated Antibody
C42950 100ul
EUR 397
anti- TPPP antibody
FNab08897 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: tubulin polymerization promoting protein
  • Uniprot ID: O94811
  • Gene ID: 11076
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against TPPP
anti- TPPP antibody
FNab08898 100µg
EUR 585
  • Immunogen: tubulin polymerization promoting protein
  • Uniprot ID: O94811
  • Gene ID: 11076
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against TPPP
TPPP (pS18) Antibody
abx219079-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Anti-TPPP antibody
PAab08897 100 ug
EUR 412
Anti-TPPP antibody
PAab08898 100 ug
EUR 412
Anti-TPPP antibody
STJ111309 100 µl
EUR 277
Anti-TPPP antibody
STJ190143 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TPPP
TPPP siRNA
20-abx937861
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TPPP siRNA
20-abx937862
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Phospho-TPPP (Ser18) Antibody
AF8329 200ul
EUR 376
Description: TPPP (Phospho-Ser18) Antibody detects endogenous levels of TPPP only when phosphorylated at Ser18.
TPPP (Phospho- Ser18) Antibody
ABF8329 100 ug
EUR 438
TPPP (Phospho-Ser18) Antibody
12649-100ul 100ul
EUR 252
TPPP (Phospho-Ser18) Antibody
12649-50ul 50ul
EUR 187
Anti-TPPP/p25 antibody
STJ72121 100 µg
EUR 359
TPPP cloning plasmid
CSB-CL024115HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: ATGGCTGACAAGGCCAAGCCTGCCAAAGCTGCCAACAGGACGCCCCCCAAGTCCCCGGGGGACCCCTCGAAGGACCGGGCAGCCAAGAGGCTGTCGCTGGAATCGGAGGGTGCTGGTGAGGGGGCAGCCGCATCCCCTGAGCTCAGTGCCCTGGAGGAGGCCTTCCGGCGCTTTGC
  • Show more
Description: A cloning plasmid for the TPPP gene.
TPPP Blocking Peptide
33R-4660 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPPP antibody, catalog no. 70R-10328
TPPP Blocking Peptide
DF7880-BP 1mg
EUR 195
Monoclonal TPPP Antibody, Clone: EPR3315
APR13782G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TPPP. The antibodies are raised in Rabbit and are from clone EPR3315. This antibody is applicable in WB and IHC
Monoclonal TPPP Antibody, Clone: EPR3316
APR13783G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TPPP. The antibodies are raised in Rabbit and are from clone EPR3316. This antibody is applicable in WB, IHC and IF
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse)
4-PAA993Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP)
Rabbit Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx362823-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC
4-PAA993Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA993Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Biotin.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA993Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Cy3.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), FITC
4-PAA993Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with FITC.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), HRP
4-PAA993Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with HRP.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), PE
4-PAA993Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with PE.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx123553
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx116340
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx104140
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx029266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx029266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx174961
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx322624
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx430016-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx238897-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx238898-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx178749
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx178750
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Mouse TPPP shRNA Plasmid
20-abx977885
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TPPP ELISA Kit
EHT0320 96Tests
EUR 521
Goat TPPP ELISA Kit
EGTT0320 96Tests
EUR 521
Bovine TPPP ELISA Kit
EBT0320 96Tests
EUR 521
Chicken TPPP ELISA Kit
ECKT0320 96Tests
EUR 521
Anserini TPPP ELISA Kit
EAT0320 96Tests
EUR 521
Canine TPPP ELISA Kit
ECT0320 96Tests
EUR 521
TPPP ELISA KIT|Human
EF007225 96 Tests
EUR 689
Porcine TPPP ELISA Kit
EPT0320 96Tests
EUR 521
Rat TPPP ELISA Kit
ERT0320 96Tests
EUR 521
Sheep TPPP ELISA Kit
EST0320 96Tests
EUR 521
Monkey TPPP ELISA Kit
EMKT0320 96Tests
EUR 521
Mouse TPPP ELISA Kit
EMT0320 96Tests
EUR 521
Human TPPP shRNA Plasmid
20-abx957573
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TPPP Recombinant Protein (Human)
RP044413 100 ug Ask for price
TPPP Recombinant Protein (Rat)
RP234431 100 ug Ask for price
TPPP Recombinant Protein (Mouse)
RP180746 100 ug Ask for price
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA993Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC-Cy7.
Phospho-TPPP (Ser18) Blocking Peptide
AF8329-BP 1mg
EUR 195
Guinea Pig TPPP ELISA Kit
EGT0320 96Tests
EUR 521
Tppp ORF Vector (Rat) (pORF)
ORF078145 1.0 ug DNA
EUR 506
TPPP ORF Vector (Human) (pORF)
ORF014805 1.0 ug DNA
EUR 354
Tppp ORF Vector (Mouse) (pORF)
ORF060250 1.0 ug DNA
EUR 506
TPPP ELISA Kit (Human) (OKCD01559)
OKCD01559 96 Wells
EUR 792
Description: Description of target: May play a role in the polymerization of tubulin into microtubules, microtubule bundling and the stabilization of existing microtubules, thus maintaining the integrity of the microtubule network. May play a role in mitotic spindle assembly and nuclear envelope breakdown.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.128 ng/mL
TPPP ELISA Kit (Mouse) (OKCD07044)
OKCD07044 96 Wells
EUR 779
Description: Description of target: This protein was disclosed by the RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full length complementary DNAs and physical mapping of the corresponding genes to the mouse genome.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL
TPPP ELISA Kit (Mouse) (OKDD00629)
OKDD00629 96 Wells
EUR 909
Description: Description of target: May play a role in the polymerization of tubulin into microtubules, microtubule bundling and the stabilization of existing microtubules, thus maintaining the integrity of the microtubule network. may play a role in mitotic spindle assembly and nuclear envelope breakdown.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.053 ng/mL
TPPP ELISA Kit (Rat) (OKEI00871)
OKEI00871 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx262669
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
TPPP sgRNA CRISPR Lentivector set (Human)
K2429501 3 x 1.0 ug
EUR 339
Tppp sgRNA CRISPR Lentivector set (Mouse)
K3517101 3 x 1.0 ug
EUR 339
Tppp sgRNA CRISPR Lentivector set (Rat)
K6181001 3 x 1.0 ug
EUR 339
Human Tubulin polymerization-promoting protein (TPPP)
1-CSB-EP024115HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tubulin polymerization-promoting protein(TPPP) expressed in E.coli
Recombinant Tubulin Polymerization Promoting Protein (TPPP)
4-RPA993Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94811
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: 9.5
Description: Recombinant Human Tubulin Polymerization Promoting Protein expressed in: E.coli
Mouse Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx655371
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx655372
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx069525
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TPPP sgRNA CRISPR Lentivector (Human) (Target 1)
K2429502 1.0 ug DNA
EUR 154
TPPP sgRNA CRISPR Lentivector (Human) (Target 2)
K2429503 1.0 ug DNA
EUR 154
TPPP sgRNA CRISPR Lentivector (Human) (Target 3)
K2429504 1.0 ug DNA
EUR 154
Tppp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3517102 1.0 ug DNA
EUR 154
Tppp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3517103 1.0 ug DNA
EUR 154
Tppp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3517104 1.0 ug DNA
EUR 154
Tppp sgRNA CRISPR Lentivector (Rat) (Target 1)
K6181002 1.0 ug DNA
EUR 154
Tppp sgRNA CRISPR Lentivector (Rat) (Target 2)
K6181003 1.0 ug DNA
EUR 154
Tppp sgRNA CRISPR Lentivector (Rat) (Target 3)
K6181004 1.0 ug DNA
EUR 154
TPPP Protein Vector (Human) (pPB-C-His)
PV059217 500 ng
EUR 481
TPPP Protein Vector (Human) (pPB-N-His)
PV059218 500 ng
EUR 481
TPPP Protein Vector (Human) (pPM-C-HA)
PV059219 500 ng
EUR 481
TPPP Protein Vector (Human) (pPM-C-His)
PV059220 500 ng
EUR 481
TPPP Protein Vector (Rat) (pPB-C-His)
PV312578 500 ng
EUR 603
TPPP Protein Vector (Rat) (pPB-N-His)
PV312579 500 ng
EUR 603
TPPP Protein Vector (Rat) (pPM-C-HA)
PV312580 500 ng
EUR 603
TPPP Protein Vector (Rat) (pPM-C-His)
PV312581 500 ng
EUR 603
TPPP Protein Vector (Mouse) (pPB-C-His)
PV240998 500 ng
EUR 603
TPPP Protein Vector (Mouse) (pPB-N-His)
PV240999 500 ng
EUR 603
TPPP Protein Vector (Mouse) (pPM-C-HA)
PV241000 500 ng
EUR 603
TPPP Protein Vector (Mouse) (pPM-C-His)
PV241001 500 ng
EUR 603
Tppp 3'UTR GFP Stable Cell Line
TU170996 1.0 ml Ask for price
TPPP 3'UTR GFP Stable Cell Line
TU076170 1.0 ml
EUR 2333
Tppp 3'UTR Luciferase Stable Cell Line
TU120996 1.0 ml Ask for price
TPPP 3'UTR Luciferase Stable Cell Line
TU026170 1.0 ml
EUR 2333
Tppp 3'UTR Luciferase Stable Cell Line
TU222352 1.0 ml Ask for price
Tppp 3'UTR GFP Stable Cell Line
TU272352 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TPPP Rabbit Polyclonal Antibody