APLF Rabbit Polyclonal Antibody

APLF Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

APLF Polyclonal Antibody

ABP57789-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human APLF protein
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse, Rat. This APLF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APLF protein

APLF Polyclonal Antibody

ABP57789-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human APLF protein
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse, Rat. This APLF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APLF protein

APLF Polyclonal Antibody

ABP57789-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human APLF protein
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse, Rat. This APLF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APLF protein

APLF Polyclonal Antibody

ES5104-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against APLF from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

APLF Polyclonal Antibody

ES5104-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APLF from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

APLF Polyclonal Antibody

ES8910-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against APLF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

APLF Polyclonal Antibody

ES8910-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APLF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

APLF antibody

70R-15766 50 ul
EUR 435
Description: Rabbit polyclonal APLF antibody

APLF Antibody

36118-100ul 100ul
EUR 252

APLF Antibody

1-CSB-PA825036
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APLF. Recognizes APLF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

APLF Antibody

1-CSB-PA001908GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against APLF. Recognizes APLF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

APLF Antibody

1-CSB-PA784037
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APLF. Recognizes APLF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

APLF antibody

70R-34460 100 ug
EUR 327
Description: Rabbit polyclonal APLF antibody

APLF Antibody

AF0108 200ul
EUR 304
Description: APLF antibody detects endogenous levels of total APLF.

APLF Antibody

1-CSB-PA008030
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APLF. Recognizes APLF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

APLF Antibody

ABF0108 100 ug
EUR 438

APLF (phospho Ser116) Polyclonal Antibody

ABP54104-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human APLF around the phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF phospho Ser116) from Human, Mouse. This APLF phospho Ser116) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the phosphorylation site of S116

APLF (phospho Ser116) Polyclonal Antibody

ABP54104-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human APLF around the phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF phospho Ser116) from Human, Mouse. This APLF phospho Ser116) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the phosphorylation site of S116

APLF (phospho Ser116) Polyclonal Antibody

ABP54104-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human APLF around the phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF phospho Ser116) from Human, Mouse. This APLF phospho Ser116) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the phosphorylation site of S116

APLF (phospho Ser116) Polyclonal Antibody

ES5103-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against APLF (phospho Ser116) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

APLF (phospho Ser116) Polyclonal Antibody

ES5103-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APLF (phospho Ser116) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

APLF (Phospho-Ser116) Polyclonal Conjugated Antibody

C12573 100ul
EUR 397

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

APLF (pS116) Antibody

abx148234-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

anti- APLF antibody

FNab00484 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: aprataxin and PNKP like factor
  • Uniprot ID: Q8IW19
  • Gene ID: 200558
  • Research Area: Metabolism
Description: Antibody raised against APLF

Anti-APLF antibody

PAab00484 100 ug
EUR 355

Anti-APLF antibody

STJ91631 200 µl
EUR 197
Description: Rabbit polyclonal to APLF.

Anti-APLF antibody

STJ99628 200 µl
EUR 197
Description: Rabbit polyclonal to APLF.

APLF siRNA

20-abx907796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APLF siRNA

20-abx907797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APLF (Ab-116) Antibody

33273-100ul 100ul
EUR 252

APLF (Ab-116) Antibody

33273-50ul 50ul
EUR 187

APLF (Phospho-Ser116) Antibody

12573-100ul 100ul
EUR 252

APLF (Phospho-Ser116) Antibody

12573-50ul 50ul
EUR 187

APLF (Ab-116) Antibody

CSB-PA109959-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APLF (Ab-116). Recognizes APLF (Ab-116) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

APLF (Ab-116) Antibody

CSB-PA109959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APLF (Ab-116). Recognizes APLF (Ab-116) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-APLF (S116) Antibody

1-CSB-PA008028
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-APLF (S116). Recognizes Phospho-APLF (S116) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Phospho-APLF (Ser116) Antibody

AF8241 200ul
EUR 376
Description: APLF (Phospho-Ser116) Antibody detects endogenous levels of APLF only when phosphorylated at Ser116.

APLF (Phospho- Ser116) Antibody

ABF8241 100 ug
EUR 438

APLF Blocking Peptide

AF0108-BP 1mg
EUR 195

APLF cloning plasmid

CSB-CL814212HU-10ug 10ug
EUR 539
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1536
  • Sequence: atgtccgggggcttcgagctgcagccgcgggacggcggtccccgggtggccctggcgcccggggagacggtgatcggccgcgggccgctgctgggaataacagacaagagagtatccagaagacatgccattcttgaggtggcaggtggtcagctgcgaatcaaaccgatacaca
  • Show more
Description: A cloning plasmid for the APLF gene.

Anti-APLF (Ab-116) Antibody

A06828 100ul
EUR 397
Description: Rabbit Polyclonal APLF (Ab-116) Antibody. Validated in IHC, WB and tested in Human.

APLF (Ab-116) Conjugated Antibody

C33273 100ul
EUR 397

Anti-Phospho-APLF (S116) antibody

STJ91238 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-APLF (S116).

APLF ELISA KIT|Human

EF007822 96 Tests
EUR 689

Mouse APLF shRNA Plasmid

20-abx977670
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human APLF shRNA Plasmid

20-abx966254
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-APLF Plasmid

PVT16788 2 ug
EUR 325

APLF Recombinant Protein (Human)

RP001531 100 ug Ask for price

APLF Recombinant Protein (Mouse)

RP116390 100 ug Ask for price

APLF Recombinant Protein (Mouse)

RP116393 100 ug Ask for price

APLF Recombinant Protein (Rat)

RP190514 100 ug Ask for price

Rabbit Apaxin and PNK-like factor(APLF) ELISA kit

E04A1591-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apaxin and PNK-like factor(APLF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apaxin and PNK-like factor(APLF) ELISA kit

E04A1591-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apaxin and PNK-like factor(APLF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apaxin and PNK-like factor(APLF) ELISA kit

E04A1591-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apaxin and PNK-like factor(APLF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aprataxin And PNKP Like Factor (APLF) Antibody

20-abx210495
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

20-abx111036
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

20-abx012964
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

20-abx339818
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

abx331532-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

20-abx325901
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody

abx230484-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Phospho-APLF (Ser116) Blocking Peptide

AF8241-BP 1mg
EUR 195

Aplf ORF Vector (Rat) (pORF)

ORF063506 1.0 ug DNA
EUR 506

APLF ORF Vector (Human) (pORF)

ORF000511 1.0 ug DNA
EUR 95

Aplf ORF Vector (Mouse) (pORF)

ORF038798 1.0 ug DNA
EUR 506

Aplf ORF Vector (Mouse) (pORF)

ORF038799 1.0 ug DNA
EUR 506

APLF ELISA Kit (Human) (OKEH08577)

OKEH08577 96 Wells
EUR 896
Description: Description of target: C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086ng/mL

Aplf sgRNA CRISPR Lentivector set (Rat)

K6370501 3 x 1.0 ug
EUR 339

Aplf sgRNA CRISPR Lentivector set (Mouse)

K3249501 3 x 1.0 ug
EUR 339

APLF sgRNA CRISPR Lentivector set (Human)

K0104201 3 x 1.0 ug
EUR 339

Aplf sgRNA CRISPR Lentivector (Rat) (Target 1)

K6370502 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Rat) (Target 2)

K6370503 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Rat) (Target 3)

K6370504 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3249502 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3249503 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3249504 1.0 ug DNA
EUR 154

APLF sgRNA CRISPR Lentivector (Human) (Target 1)

K0104202 1.0 ug DNA
EUR 154

APLF sgRNA CRISPR Lentivector (Human) (Target 2)

K0104203 1.0 ug DNA
EUR 154

APLF sgRNA CRISPR Lentivector (Human) (Target 3)

K0104204 1.0 ug DNA
EUR 154

APLF Protein Vector (Mouse) (pPB-C-His)

PV155190 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPB-N-His)

PV155191 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-HA)

PV155192 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-His)

PV155193 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPB-C-His)

PV155194 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPB-N-His)

PV155195 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-HA)

PV155196 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-His)

PV155197 500 ng
EUR 603

APLF Protein Vector (Rat) (pPB-C-His)

PV254022 500 ng
EUR 603

APLF Protein Vector (Rat) (pPB-N-His)

PV254023 500 ng
EUR 603

APLF Protein Vector (Rat) (pPM-C-HA)

PV254024 500 ng
EUR 603

APLF Protein Vector (Rat) (pPM-C-His)

PV254025 500 ng
EUR 603

APLF Protein Vector (Human) (pPB-His-MBP)

PV322758 500 ng
EUR 329

APLF Protein Vector (Human) (pPB-His-GST)

PV322759 500 ng
EUR 329

APLF Protein Vector (Human) (pPB-C-His)

PV002041 500 ng
EUR 329

APLF Protein Vector (Human) (pPB-N-His)

PV002042 500 ng
EUR 329

APLF Protein Vector (Human) (pPM-C-HA)

PV002043 500 ng
EUR 329

APLF Protein Vector (Human) (pPM-C-His)

PV002044 500 ng
EUR 329

Aplf 3'UTR GFP Stable Cell Line

TU151946 1.0 ml Ask for price

Aplf 3'UTR Luciferase Stable Cell Line

TU101946 1.0 ml Ask for price

Aplf 3'UTR Luciferase Stable Cell Line

TU200751 1.0 ml Ask for price

Aplf 3'UTR GFP Stable Cell Line

TU250751 1.0 ml Ask for price

APLF 3'UTR GFP Stable Cell Line

TU050947 1.0 ml
EUR 1521

APLF 3'UTR Luciferase Stable Cell Line

TU000947 1.0 ml
EUR 1521

Aprataxin And PNKP Like Factor Phospho-Ser116 (APLF pS116) Antibody

20-abx325264
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

APLF Rabbit Polyclonal Antibody