SPHK1 Rabbit Polyclonal Antibody

SPHK1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

SPHK1 Polyclonal Antibody
ES8981-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPHK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
SPHK1 Polyclonal Antibody
ABP60494-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SPHK1 from Human. This SPHK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
SPHK1 Polyclonal Antibody
ABP60494-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SPHK1 from Human. This SPHK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
SPHK1 Polyclonal Antibody
ABP60494-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SPHK1 from Human. This SPHK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
DLR-SPHK1-Hu-48T 48T
EUR 517
  • Should the Human Sphingosine Kinase 1 (SPHK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine Kinase 1 (SPHK1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
DLR-SPHK1-Hu-96T 96T
EUR 673
  • Should the Human Sphingosine Kinase 1 (SPHK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine Kinase 1 (SPHK1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
RD-SPHK1-Hu-48Tests 48 Tests
EUR 521
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
RD-SPHK1-Hu-96Tests 96 Tests
EUR 723
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
RDR-SPHK1-Hu-48Tests 48 Tests
EUR 544
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
RDR-SPHK1-Hu-96Tests 96 Tests
EUR 756
SPHK1 Rabbit pAb
A0139-100ul 100 ul
EUR 308
SPHK1 Rabbit pAb
A0139-200ul 200 ul
EUR 459
SPHK1 Rabbit pAb
A0139-20ul 20 ul
EUR 183
SPHK1 Rabbit pAb
A0139-50ul 50 ul
EUR 223
SPHK1 Rabbit pAb
A0660-100ul 100 ul
EUR 308
SPHK1 Rabbit pAb
A0660-200ul 200 ul
EUR 459
SPHK1 Rabbit pAb
A0660-20ul 20 ul
EUR 183
SPHK1 Rabbit pAb
A0660-50ul 50 ul
EUR 223
Polyclonal SPHK1 Antibody (Center)
APR06976G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 (Center). This antibody is tested and proven to work in the following applications:
Polyclonal SPHK1 antibody - middle region
APR10218G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal SPHK1 Antibody (N-term)
APR10830G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-SPHK1 Antibody
APR07129G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SPHK1 . This antibody is tested and proven to work in the following applications:
SPHK1 Antibody
ABD6005 100 ug
EUR 438
SPHK1 Antibody
49581-100ul 100ul
EUR 333
SPHK1 Antibody
49581-50ul 50ul
EUR 239
SPHK1 Antibody
32004-100ul 100ul
EUR 252
SPHK1 antibody
20R-SR023 50 ug
EUR 656
Description: Rabbit polyclonal SPHK1 antibody
SPHK1 antibody
20R-SR024 50 ug
EUR 656
Description: Rabbit polyclonal SPHK1 antibody
SPHK1 antibody
70R-20491 50 ul
EUR 435
Description: Rabbit polyclonal SPHK1 antibody
SPHK1 Antibody
DF6005 200ul
EUR 304
Description: SPHK1 Antibody detects endogenous levels of total SPHK1.
SPHK1 Antibody
1-CSB-PA022564GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
SPHK1 Antibody
1-CSB-PA022564LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
Polyclonal SPHK / SPHK1 Antibody (N-Terminus)
APR10216G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK / SPHK1 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal SPHK / SPHK1 Antibody (N-Terminus)
APR10217G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK / SPHK1 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal SPHK1 Antibody (N-term P74)
APR07043G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 (N-term P74). This antibody is tested and proven to work in the following applications:
SPHK1 (Phospho-Ser225) Polyclonal Conjugated Antibody
C12639 100ul
EUR 397
Sphingosine kinase I (SPHK1) polyclonal antibody
ABP-PAB-11348 100 ug Ask for price
    • Product line: Kinases
    • Brand:
SPHK1 Conjugated Antibody
C49581 100ul
EUR 397
SPHK1 Conjugated Antibody
C32004 100ul
EUR 397
anti- SPHK1 antibody
FNab08173 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: sphingosine kinase 1
  • Uniprot ID: Q9NYA1
  • Gene ID: 8877
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against SPHK1
SPHK1 (pS225) Antibody
abx218735-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Anti-SPHK1 antibody
PAab08173 100 ug
EUR 386
Anti-SPHK1 Antibody
PA1996 100ug/vial
EUR 334
Anti-SPHK1 Antibody
STJ503116 100 µg
EUR 476
Anti-SPHK1 antibody
STJ71503 100 µg
EUR 359
Anti-SPHK1 antibody
STJ25673 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-SPHK1 antibody
STJ114892 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-SPHK1 antibody
STJ190139 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPHK1
Sphk1/ Rat Sphk1 ELISA Kit
ELI-06936r 96 Tests
EUR 886
SPHK1 siRNA
20-abx905244
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SPHK1 siRNA
20-abx934943
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SPHK1 siRNA
20-abx934944
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SPHK1
YF-PA15947 50 ug
EUR 363
Description: Mouse polyclonal to SPHK1
anti-SPHK1
YF-PA15948 100 ul
EUR 403
Description: Rabbit polyclonal to SPHK1
anti-SPHK1
YF-PA15949 100 ug
EUR 403
Description: Rabbit polyclonal to SPHK1
anti-SPHK1
YF-PA25219 50 ul
EUR 334
Description: Mouse polyclonal to SPHK1
Phospho-SPHK1 (Ser225) Antibody
AF8318 200ul
EUR 376
Description: SPHK1 (Phospho-Ser225) Antibody detects endogenous levels of SPHK1 only when phosphorylated at Ser225.
SPHK1 (Phospho- Ser225) Antibody
ABF8318 100 ug
EUR 438
SPHK1 (Phospho-Ser225) Antibody
12639-100ul 100ul
EUR 252
SPHK1 (Phospho-Ser225) Antibody
12639-50ul 50ul
EUR 187
SPHK1 Antibody, HRP conjugated
1-CSB-PA022564LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SPHK1 Antibody, FITC conjugated
1-CSB-PA022564LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SPHK1 Antibody, Biotin conjugated
1-CSB-PA022564LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-SPHK1 Monoclonal Antibody
M01390 100ug
EUR 397
Description: Rabbit Monoclonal SPHK1 Antibody. Validated in Flow Cytometry, WB and tested in Human, Mouse, Rat.
Anti-SPHK1 Antibody BIOTIN
STJ503117 100 µg
EUR 586
Anti-SPHK1 Antibody FITC
STJ503118 100 µg
EUR 586
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse)
4-PAE698Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1)
SPHK1 cloning plasmid
CSB-CL022564HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1197
  • Sequence: atggatccagtggtcggttgcggacgtggcctctttggttttgttttctcagcgggcggcccccggggcgtgctcccgcggccctgccgcgtgctggtgctgctgaacccgcgcggcggcaagggcaaggccttgcagctcttccggagtcacgtgcagccccttttggctgagg
  • Show more
Description: A cloning plasmid for the SPHK1 gene.
SPHK1 cloning plasmid
CSB-CL022564HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1155
  • Sequence: atggatccagcgggcggcccccggggcgtgctcccgcggccctgccgcgtgctggtgctgctgaacccgcgcggcggcaagggcaaggccttgcagctcttccggagtcacgtgcagccccttttggctgaggctgaaatctccttcacgctgatgctcactgagcggcggaacc
  • Show more
Description: A cloning plasmid for the SPHK1 gene.
SPHK1 cloning plasmid
CSB-CL022564HU3-10ug 10ug
EUR 506
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgtccgctcaagttctgggatttttacgcagctggactcccctccccctggcagccccgaggggtccagccgccgcagggaatgacgccggtgctcctacagccacggctccgggcggggaaggcgagccccacagccggccctgcgacgcccgcctgggcagcaccgataagg
  • Show more
Description: A cloning plasmid for the SPHK1 gene.
SPHK1 cloning plasmid
CSB-CL022564HU4-10ug 10ug
EUR 506
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgtccgctcaagttctgggatttttacgcagctggactcccctccccctggcagccccgaggggtccagccgccgcagggaatgacgccggtgctcctacagccacggctccgggcggggaaggcgagccccacagccggccctgcgacgcccgcctgggcagcaccgataagg
  • Show more
Description: A cloning plasmid for the SPHK1 gene.
SPHK1 Blocking Peptide
DF6005-BP 1mg
EUR 195
Anti-SPHK1 (2A8)
YF-MA16585 100 ug
EUR 363
Description: Mouse monoclonal to SPHK1
Anti-SPHK1 (1D6)
YF-MA11127 100 ug
EUR 363
Description: Mouse monoclonal to SPHK1
anti- SPHK1-Phospho-Ser225 antibody
FNab08174 100µg
EUR 585
  • Immunogen: sphingosine kinase 1
  • Uniprot ID: Q9NYA1
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against SPHK1-Phospho-Ser225
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx115782
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx000568
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx142240
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx102190
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx033251-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx033251-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx033252-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx033252-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx033253-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx033253-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx025123-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx025123-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx174621
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx318019
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx431609-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
20-abx270294
  • EUR 495.00
  • EUR 578.00
  • EUR 286.00
  • EUR 885.00
  • EUR 370.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.
Sphingosine Kinase 1 (SPHK1) Antibody
abx238173-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Anti-SPHK1-Phospho-Ser225 antibody
PAab08174 100 ug
EUR 412
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), APC
4-PAE698Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with APC.
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAE698Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with Biotin.
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAE698Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with Cy3.
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), FITC
4-PAE698Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with FITC.
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), HRP
4-PAE698Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with HRP.
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), PE
4-PAE698Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with PE.
Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAE698Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1). This antibody is labeled with APC-Cy7.
Sphingosine Kinase 1 (SPHK1) Antibody (HRP)
20-abx314347
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody (FITC)
20-abx314348
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1) Antibody (Biotin)
20-abx314349
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sphingosine Kinase 1 (SPHK1 pS225) Antibody
abx238174-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Rat SPHK1 shRNA Plasmid
20-abx987623
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SPHK1 ELISA KIT|Human
EF003184 96 Tests
EUR 689
Human SPHK1 shRNA Plasmid
20-abx955864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SPHK1 shRNA Plasmid
20-abx972845
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Phospho-SPHK1 (Ser225) Blocking Peptide
AF8318-BP 1mg
EUR 195
Human SPHK1 PicoKine ELISA Kit
EK1501 96 wells
EUR 425
Description: For quantitative detection of human SPHK1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
ELISA kit for Human SPHK1
EK5704 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human SPHK1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Sphk1 ORF Vector (Mouse) (pORF)
ORF058329 1.0 ug DNA
EUR 506
Sphk1 ORF Vector (Mouse) (pORF)
ORF058330 1.0 ug DNA
EUR 506
Sphk1 ORF Vector (Mouse) (pORF)
ORF058331 1.0 ug DNA
EUR 506
Sphk1 ORF Vector (Mouse) (pORF)
ORF058332 1.0 ug DNA
EUR 506
Sphk1 ORF Vector (Mouse) (pORF)
ORF058333 1.0 ug DNA
EUR 506
SPHK1 ORF Vector (Human) (pORF)
ORF009963 1.0 ug DNA
EUR 95
SPHK1 ORF Vector (Human) (pORF)
ORF009964 1.0 ug DNA
EUR 95
SPHK1 ORF Vector (Human) (pORF)
ORF009965 1.0 ug DNA
EUR 95
SPHK1 ORF Vector (Human) (pORF)
ORF009966 1.0 ug DNA
EUR 95
Sphk1 ORF Vector (Rat) (pORF)
ORF076931 1.0 ug DNA
EUR 506
Recombinant Sphingosine Kinase 1 (SPHK1)
4-RPE698Hu01
  • EUR 583.84
  • EUR 259.00
  • EUR 1914.40
  • EUR 704.80
  • EUR 1309.60
  • EUR 454.00
  • EUR 4636.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NYA1
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Sphingosine Kinase 1 expressed in: E.coli
pECMV-Sphk1-m-FLAG Plasmid
PVT15764 2 ug
EUR 325
SPHK1 ELISA Kit (Human) (OKAN05955)
OKAN05955 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Phosphorylation of this protein alters its catalytic activity and promotes its translocation to the plasma membrane. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.129 ng/mL
SPHK1 ELISA Kit (Human) (OKCD02907)
OKCD02907 96 Wells
EUR 831
Description: Description of target: Catalyzes the phosphorylation of sphingosine to form sphingosine 1-phosphate (SPP), a lipid mediator with both intra- and extracellular functions. Also acts on D-erythro-sphingosine and to a lesser extent sphinganine, but not other lipids, such as D,L-threo-dihydrosphingosine, N,N-dimethylsphingosine, diacylglycerol, ceramide, or phosphatidylinositol.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.122 ng/mL
SPHK1 ELISA Kit (Human) (OKBB01031)
OKBB01031 96 Wells
EUR 505
Description: Description of target: Sphingosine kinase 1 is an enzyme that in humans is encoded by the SPHK1 gene. The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1- phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
Sphk1 ELISA Kit (Mouse) (OKEH04788)
OKEH04788 96 Wells
EUR 662
Description: Description of target: This gene encodes a kinase that phosphorylates sphingosine into sphingosine-1-phosphate, which is involved in cell differentiation, motility, and apoptosis. The encoded protein plays a role in maintaining cellular levels of sphingosine-1-phosphate. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.75 pg/mL
SPHK1 ELISA Kit (Rat) (OKEH06047)
OKEH06047 96 Wells
EUR 662
Description: Description of target: Catalyzes the phosphorylation of sphingosine to form sphingosine 1-phosphate (SPP), a lipid mediator with both intra- and extracellular functions. Also acts on D-erythro-sphingosine and to a lesser extent sphinganine, but not other lipids, such as D,L-threo-dihydrosphingosine, N,N-dimethylsphingosine, diacylglycerol, ceramide, or phosphatidylinositol.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.76 pg/mL
SPHK1 ELISA Kit (Human) (OKEH07170)
OKEH07170 96 Wells
EUR 662
Description: Description of target: Catalyzes the phosphorylation of sphingosine to form sphingosine 1-phosphate (SPP), a lipid mediator with both intra- and extracellular functions. Also acts on D-erythro-sphingosine and to a lesser extent sphinganine, but not other lipids, such as D,L-threo-dihydrosphingosine, N,N-dimethylsphingosine, diacylglycerol, ceramide, or phosphatidylinositol.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL
SPHK1-Phospho-Ser225 ELISA KIT|Human
EF003185 96 Tests
EUR 689
Human Sphingosine Kinase 1 (SPHK1) Protein
20-abx069144
  • EUR 815.00
  • EUR 314.00
  • EUR 2569.00
  • EUR 968.00
  • EUR 565.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SPHK1 sgRNA CRISPR Lentivector set (Human)
K2274801 3 x 1.0 ug
EUR 339
Sphk1 sgRNA CRISPR Lentivector set (Mouse)
K4399501 3 x 1.0 ug
EUR 339
Sphk1 sgRNA CRISPR Lentivector set (Rat)
K7529501 3 x 1.0 ug
EUR 339
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
abx519596-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Mouse Sphingosine kinase 1 (SPHK1) ELISA Kit
abx519597-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Sphingosine kinase 1 (SPHK1) ELISA Kit
abx519598-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
abx572808-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Mouse Sphk1/ Sphingosine kinase 1 ELISA Kit
E1402Mo 1 Kit
EUR 571
Human SPHK1/ Sphingosine kinase 1 ELISA Kit
E2376Hu 1 Kit
EUR 571
Human Sphingosine kinase 1, SPHK1 ELISA KIT
ELI-06935h 96 Tests
EUR 824
Mouse Sphingosine kinase 1, Sphk1 ELISA KIT
ELI-06937m 96 Tests
EUR 865
Human Sphingosine Kinase 1 (SPHK1) ELISA Kit
20-abx153152
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Sphingosine Kinase 1 (SPHK1) CLIA Kit
20-abx494706
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
SPHK1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2274802 1.0 ug DNA
EUR 154
SPHK1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2274803 1.0 ug DNA
EUR 154
SPHK1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2274804 1.0 ug DNA
EUR 154
Sphk1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4399502 1.0 ug DNA
EUR 154
Sphk1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4399503 1.0 ug DNA
EUR 154
Sphk1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4399504 1.0 ug DNA
EUR 154
Sphk1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7529502 1.0 ug DNA
EUR 154
Sphk1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7529503 1.0 ug DNA
EUR 154
Sphk1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7529504 1.0 ug DNA
EUR 154
SPHK1 Protein Vector (Human) (pPB-C-His)
PV039849 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-N-His)
PV039850 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-HA)
PV039851 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-His)
PV039852 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-C-His)
PV039853 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-N-His)
PV039854 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-HA)
PV039855 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-His)
PV039856 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-C-His)
PV039857 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-N-His)
PV039858 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-HA)
PV039859 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-His)
PV039860 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-C-His)
PV039861 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPB-N-His)
PV039862 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-HA)
PV039863 500 ng
EUR 329
SPHK1 Protein Vector (Human) (pPM-C-His)
PV039864 500 ng
EUR 329
Human Sphingosine Kinase 1 ELISA Kit (SPHK1)
RK02324 96 Tests
EUR 521
Human Sphingosine Kinase 1(SPHK1)ELISA Kit
QY-E01867 96T
EUR 361
SPHK1 Protein Vector (Rat) (pPB-C-His)
PV307722 500 ng
EUR 603
SPHK1 Protein Vector (Rat) (pPB-N-His)
PV307723 500 ng
EUR 603
SPHK1 Protein Vector (Rat) (pPM-C-HA)
PV307724 500 ng
EUR 603
SPHK1 Protein Vector (Rat) (pPM-C-His)
PV307725 500 ng
EUR 603
SPHK1 Protein Vector (Mouse) (pPB-C-His)
PV233314 500 ng
EUR 603

SPHK1 Rabbit Polyclonal Antibody