SUMO2 Rabbit Polyclonal Antibody

SUMO2 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

SUMO2 Polyclonal Antibody

ABP60553-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90

SUMO2 Polyclonal Antibody

ES9018-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SUMO2 Polyclonal Antibody

ES9018-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SUMO2 Rabbit pAb

A2486-100ul 100 ul
EUR 308

SUMO2 Rabbit pAb

A2486-200ul 200 ul
EUR 459

SUMO2 Rabbit pAb

A2486-20ul 20 ul
EUR 183

SUMO2 Rabbit pAb

A2486-50ul 50 ul
EUR 223

SUMO2 Rabbit pAb

A2571-100ul 100 ul
EUR 308

SUMO2 Rabbit pAb

A2571-200ul 200 ul
EUR 459

SUMO2 Rabbit pAb

A2571-20ul 20 ul
EUR 183

SUMO2 Rabbit pAb

A2571-50ul 50 ul
EUR 223

SUMO2 Rabbit pAb

A1523-100ul 100 ul
EUR 308

SUMO2 Rabbit pAb

A1523-200ul 200 ul
EUR 459

SUMO2 Rabbit pAb

A1523-20ul 20 ul
EUR 183

SUMO2 Rabbit pAb

A1523-50ul 50 ul
EUR 223

Polyclonal SUMO2/3 Antibody

APR06632G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO2/3 . This antibody is tested and proven to work in the following applications:

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

DLR-SUMO2-Hu-48T 48T
EUR 517
  • Should the Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

DLR-SUMO2-Hu-96T 96T
EUR 673
  • Should the Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

RD-SUMO2-Hu-48Tests 48 Tests
EUR 521

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

RD-SUMO2-Hu-96Tests 96 Tests
EUR 723

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

RDR-SUMO2-Hu-48Tests 48 Tests
EUR 544

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

RDR-SUMO2-Hu-96Tests 96 Tests
EUR 756

SUMO2/3 (SUMO2/3) Antibody

20-abx008699
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx026675-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx026675-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx026676-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx026676-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx026683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx026683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody

abx238390-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SUMO2/3 (SUMO2/3) Antibody

abx238391-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Polyclonal SUMO2 Antibody (aa44-93)

APR03220G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO2 (aa44-93). This antibody is tested and proven to work in the following applications:

Polyclonal SUMO2 Antibody (C-term)

APR03744G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO2 (C-term). This antibody is tested and proven to work in the following applications:

SUMO2 antibody

70R-20650 50 ul
EUR 435
Description: Rabbit polyclonal SUMO2 antibody

SUMO2 Antibody

32722-100ul 100ul
EUR 252

SUMO2 antibody

38405-100ul 100ul
EUR 252

SUMO2 antibody

10R-1181 100 ul
EUR 316
Description: Mouse monoclonal SUMO2 antibody

SUMO2 Antibody

1-CSB-PA05009A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SUMO2 Antibody

CSB-PA099258-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SUMO2 Antibody

CSB-PA099258-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SUMO2 Antibody

DF7024 200ul
EUR 304
Description: SUMO2 Antibody detects endogenous levels of total SUMO2.

SUMO2 Antibody

1-CSB-PA022949GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SUMO2 Antibody

ABD7024 100 ug
EUR 438

Anti-Sumo2/3 Rabbit Monoclonal Antibody

M01282-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

SUMO2

E541-030 100ug
EUR 343

Polyclonal SUMO2/3 Antibody (N-term)

APR03665G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO2/3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal SUMO2/3 Antibody (C-term)

APR03666G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO2/3 (C-term). This antibody is tested and proven to work in the following applications:

SUMO2/3 Antibody

25117-100ul 100ul
EUR 390

SUMO2/3 antibody

70R-30820 100 ug
EUR 327
Description: Rabbit polyclonal SUMO2/3 antibody

SUMO2/3 antibody

70R-30839 100 ug
EUR 327
Description: Rabbit polyclonal SUMO2/3 antibody

Human SUMO2 Antibody

32621-05111 150 ug
EUR 261

SUMO2/3 antibody

70R-50404 100 ul
EUR 244
Description: Purified Polyclonal SUMO2/3 antibody

Xenopus SUMO2 Antibody

abx027062-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Xenopus SUMO2 Antibody

abx027062-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SUMO2 Conjugated Antibody

C32722 100ul
EUR 397

Anti-SUMO2 antibody

STJ25749 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SUMO2 antibody

STJ28142 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SUMO2 antibody

STJ116151 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SUMO2 antibody

STJ190176 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SUMO2

Sumo2/ Rat Sumo2 ELISA Kit

ELI-52173r 96 Tests
EUR 886

SUMO2 protein

30R-1289 100 ug
EUR 268
Description: Purified recombinant Human SUMO2 protein

SUMO2 protein

30R-2786 100 ug
EUR 336
Description: Purified recombinant Human SUMO2 protein

SUMO2 siRNA

20-abx905375
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SUMO2 siRNA

20-abx935666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SUMO2 siRNA

20-abx935667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SUMO2

PVT12374 2 ug
EUR 391

SUMO2/SUMO3/SUMO4 Antibody

36877-100ul 100ul
EUR 252

Sumo2/3/4 Antibody

45466-100ul 100ul
EUR 252

Sumo2/3/4 Antibody

45466-50ul 50ul
EUR 187

Cleaved-SUMO2 (G93) Antibody

1-CSB-PA000062
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-SUMO2 (G93). Recognizes Cleaved-SUMO2 (G93) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

SUMO2 Antibody, HRP conjugated

1-CSB-PA05009B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SUMO2 Antibody, FITC conjugated

1-CSB-PA05009C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SUMO2 Antibody, Biotin conjugated

1-CSB-PA05009D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Sumo2/3/4 Antibody

DF8750 200ul
EUR 304
Description: Sumo2/3/4 Antibody detects endogenous levels of total Sumo2/3/4.

Sumo2 / 3 / 4 Antibody

20-abx218822
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sumo2/3/4 Antibody

ABD8750 100 ug
EUR 438

anti- SUMO2/3 antibody

FNab08390 100µg
EUR 548.75
  • Immunogen: SMT3 suppressor of mif two 3 homolog 2
  • Uniprot ID: P61956
  • Gene ID: 6613
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism
Description: Antibody raised against SUMO2/3

anti- SUMO2/3 antibody

FNab08391 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: SMT3 suppressor of mif two 3 homolog 2
  • Uniprot ID: P61956
  • Gene ID: 6613
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism
Description: Antibody raised against SUMO2/3

Anti-SUMO2/3 antibody

PAab08390 100 ug
EUR 386

Anti-SUMO2/3 antibody

PAab08391 100 ug
EUR 412

Human SUMO2/3 (SUMO2/3) ELISA Kit

abx259859-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rabbit Anti-SUMO2, SUMO3 monoclonal antibody, clone KK198-15

CABT-L819 100 ul
EUR 777

Human SUMO2 Antibody (Biotin Conjugate)

32621-05121 150 ug
EUR 369

SUMO2 / 3 (Cleaved-Gly93) Antibody

20-abx015618
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SUMO-2(SUMO2/1199) Antibody

BNUM1199-50 50uL
EUR 395
Description: Primary antibody against SUMO-2(SUMO2/1199), 1mg/mL

Sumo2/3/4 Conjugated Antibody

C45466 100ul
EUR 397

SUMO-2(SUMO2/1199) Antibody

BNUB1199-100 100uL
EUR 209
Description: Primary antibody against SUMO-2(SUMO2/1199), Concentration: 0.2mg/mL

SUMO-2(SUMO2/1199) Antibody

BNUB1199-500 500uL
EUR 458
Description: Primary antibody against SUMO-2(SUMO2/1199), Concentration: 0.2mg/mL

SUMO2/SUMO3/SUMO4 Conjugated Antibody

C36877 100ul
EUR 397

SUMO-2(SUMO2/1199) Antibody

BNC551199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF555 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC551199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF555 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC611199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF660R conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC611199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF660R conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC471199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF647 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC471199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF647 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC051199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF405M conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC051199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF405M conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC401199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF640R conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC401199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF640R conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC431199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF543 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC431199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF543 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC041199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF405S conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC041199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF405S conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC801199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF680 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC801199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF680 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCP1199-250 250uL
EUR 383
Description: Primary antibody against SUMO-2(SUMO2/1199), PerCP conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCR1199-250 250uL
EUR 383
Description: Primary antibody against SUMO-2(SUMO2/1199), RPE conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCA1199-250 250uL
EUR 383
Description: Primary antibody against SUMO-2(SUMO2/1199), APC conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCB1199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), Biotin conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCB1199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), Biotin conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCH1199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCH1199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC881199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF488A conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC881199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF488A conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC941199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF594 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC941199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF594 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC681199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF568 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC681199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF568 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC701199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF770 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC701199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF770 conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCAP1199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNCAP1199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC811199-100 100uL
EUR 199
Description: Primary antibody against SUMO-2(SUMO2/1199), CF680R conjugate, Concentration: 0.1mg/mL

SUMO-2(SUMO2/1199) Antibody

BNC811199-500 500uL
EUR 544
Description: Primary antibody against SUMO-2(SUMO2/1199), CF680R conjugate, Concentration: 0.1mg/mL

Sumo2/3 recombinant monoclonal antibody

A5199 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Sumo2/3 for WB, IF,ELISA

SUMO2, human recombinant

4942-100
EUR 251

SUMO2, human recombinant

4942-1000
EUR 1518

SUMO2 Blocking Peptide

DF7024-BP 1mg
EUR 195

Human SUMO2 Protein

abx060006-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

SUMO2-biotin Protein

E28003 50 µg
EUR 338.55
Description: reagents widely cited

SUMO2 cloning plasmid

CSB-CL022949HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag
  • Show more
Description: A cloning plasmid for the SUMO2 gene.

SUMO2 cloning plasmid

CSB-CL022949HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacaatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag
  • Show more
Description: A cloning plasmid for the SUMO2 gene.

p3*Flag- SUMO2

PVT10172 2 ug
EUR 301

pWPXLd-SUMO2 Plasmid

PVTB00794-4a 2 ug
EUR 356

Human SUMO2 AssayLite Antibody (FITC Conjugate)

32621-05141 150 ug
EUR 428

Human SUMO2 AssayLite Antibody (RPE Conjugate)

32621-05151 150 ug
EUR 428

Human SUMO2 AssayLite Antibody (APC Conjugate)

32621-05161 150 ug
EUR 428

Human SUMO2 AssayLite Antibody (PerCP Conjugate)

32621-05171 150 ug
EUR 471

Rabbit Small ubiquitin related modifier 2(SUMO2) ELISA kit

E04S0423-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 2(SUMO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Small ubiquitin related modifier 2(SUMO2) ELISA kit

E04S0423-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 2(SUMO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Small ubiquitin related modifier 2(SUMO2) ELISA kit

E04S0423-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 2(SUMO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SUMO2 / 3 Blocking Peptide

20-abx063279
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SUMO2 ELISA KIT|Human

EF007196 96 Tests
EUR 689

Rat SUMO2 shRNA Plasmid

20-abx991199
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SUMO2 shRNA Plasmid

20-abx954496
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SUMO2 shRNA Plasmid

20-abx980364
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SUMO2 Recombinant Protein (Rat)

RP231728 100 ug Ask for price

SUMO2 Recombinant Protein (Human)

RP030640 100 ug Ask for price

SUMO2 Recombinant Protein (Human)

RP030643 100 ug Ask for price

SUMO2 Recombinant Protein (Mouse)

RP176450 100 ug Ask for price

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig)

4-PAG152Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2)

Monoclonal SUMO-2 Antibody, Clone: SUMO2/1199

AMM01327G 7 ml
EUR 484
Description: A Monoclonal antibody against Human SUMO-2. The antibodies are raised in Mouse and are from clone SUMO2/1199. This antibody is applicable in IHC, IF, FC

Monoclonal SUMO2 Antibody (C-term), Clone: 973CT8.1.1

AMM02469G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SUMO2 (C-term). The antibodies are raised in Mouse and are from clone 973CT8.1.1. This antibody is applicable in WB and IF, E

Rabbit Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit

abx363013-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sumo2/3/4 Blocking Peptide

DF8750-BP 1mg
EUR 195

SUMO2/3 ELISA KIT|Human

EF003361 96 Tests
EUR 689

Sumo2 ORF Vector (Rat) (pORF)

ORF077244 1.0 ug DNA
EUR 506

SUMO2 ORF Vector (Human) (pORF)

ORF010214 1.0 ug DNA
EUR 95

SUMO2 ORF Vector (Human) (pORF)

ORF010215 1.0 ug DNA
EUR 95

Sumo2 ORF Vector (Mouse) (pORF)

ORF058818 1.0 ug DNA
EUR 506

SUMO2 ELISA Kit (Human) (OKCD01900)

OKCD01900 96 Wells
EUR 831
Description: Description of target: Ubiquitin-like protein that can be covalently attached to proteins as a monomer or as a lysine-linked polymer. Covalent attachment via an isopeptide bond to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I, and can be promoted by an E3 ligase such as PIAS1-4, RANBP2, CBX4 or ZNF451.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.126 ng/mL

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), APC

4-PAG152Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with APC.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAG152Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with Biotin.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), Cy3

4-PAG152Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with Cy3.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), FITC

4-PAG152Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with FITC.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), HRP

4-PAG152Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with HRP.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), PE

4-PAG152Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with PE.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

abx027042-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

abx027042-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx115627
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

abx036503-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx131167
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx174575
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

abx034921-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

abx034921-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

abx332499-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx327673
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx313214
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx001930
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody

20-abx002008
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAG152Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SUMO2 (Met1~Tyr95)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Small Ubiquitin Related Modifier Protein 2 (SUMO2). This antibody is labeled with APC-Cy7.

Sumo2 sgRNA CRISPR Lentivector set (Rat)

K7507001 3 x 1.0 ug
EUR 339

Sumo2 sgRNA CRISPR Lentivector set (Mouse)

K3637101 3 x 1.0 ug
EUR 339

SUMO2 sgRNA CRISPR Lentivector set (Human)

K2314401 3 x 1.0 ug
EUR 339

Anti-SUMO-2 Antibody Clone SUMO2/1199, Unconjugated-100ug

6613-MSM2-P1 100ug
EUR 428

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody (HRP)

20-abx313215
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody (FITC)

20-abx313216
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Small Ubiquitin Related Modifier Protein 2 (SUMO2) Antibody (Biotin)

20-abx313217
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

SUMO2 Rabbit Polyclonal Antibody