CDH3 Rabbit Polyclonal Antibody

CDH3 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CDH3 Polyclonal Antibody
ES8924-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDH3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CDH3 Polyclonal Antibody
ABP58081-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CDH3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDH3 from Human, Mouse, Rat. This CDH3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDH3 protein
CDH3 Polyclonal Antibody
ABP58081-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CDH3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDH3 from Human, Mouse, Rat. This CDH3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDH3 protein
CDH3 Polyclonal Antibody
ABP58081-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDH3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDH3 from Human, Mouse, Rat. This CDH3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDH3 protein
CDH3 Polyclonal Antibody
A50660 100 µg
EUR 570.55
Description: fast delivery possible
CDH3 Rabbit pAb
A0915-100ul 100 ul
EUR 308
CDH3 Rabbit pAb
A0915-200ul 200 ul
EUR 459
CDH3 Rabbit pAb
A0915-20ul 20 ul Ask for price
CDH3 Rabbit pAb
A0915-50ul 50 ul Ask for price
CDH3 Rabbit pAb
A14235-100ul 100 ul
EUR 308
CDH3 Rabbit pAb
A14235-200ul 200 ul
EUR 459
CDH3 Rabbit pAb
A14235-20ul 20 ul
EUR 183
CDH3 Rabbit pAb
A14235-50ul 50 ul
EUR 223
Polyclonal CDH3 Antibody (N-term)
APR04051G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDH3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal CDH3 Antibody (C-term)
APR04052G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDH3 (C-term). This antibody is tested and proven to work in the following applications:
CDH3 Polyclonal Antibody, HRP Conjugated
A50661 100 µg
EUR 570.55
Description: reagents widely cited
CDH3 Polyclonal Antibody, FITC Conjugated
A50662 100 µg
EUR 570.55
Description: Ask the seller for details
CDH3 Polyclonal Antibody, Biotin Conjugated
A50663 100 µg
EUR 570.55
Description: The best epigenetics products
CDH3 antibody
70R-32317 100 ug
EUR 327
Description: Rabbit polyclonal CDH3 antibody
CDH3 Antibody
ABD3531 100 ug
EUR 438
CDH3 Antibody
35871-100ul 100ul
EUR 252
CDH3 antibody
70R-1708 100 ug
EUR 377
Description: Rabbit polyclonal CDH3 antibody
CDH3 antibody
70R-13906 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CDH3 antibody
CDH3 antibody
70R-16319 50 ul
EUR 435
Description: Rabbit polyclonal CDH3 antibody
CDH3 Antibody
DF3531 200ul
EUR 304
Description: CDH3 Antibody detects endogenous levels of total CDH3.
CDH3 Antibody
1-CSB-PA005052GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CDH3 Antibody
1-CSB-PA006358
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
CDH3 Antibody
1-CSB-PA196946
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:5-1:20
CDH3 Antibody
1-CSB-PA10715A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
CDH3 Antibody
1-CSB-PA037292
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
CDH3 Conjugated Antibody
C35871 100ul
EUR 397
Anti-CDH3 antibody
STJ99642 200 µl
EUR 197
Description: Rabbit polyclonal to CDH3.
Anti-CDH3 antibody
STJ23046 100 µl
EUR 277
Description: This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. This gene is located in a gene cluster in a region on the long arm of chromosome 16 that is involved in loss of heterozygosity events in breast and prostate cancer. In addition, aberrant expression of this protein is observed in cervical adenocarcinomas. Mutations in this gene are associated with hypotrichosis with juvenile macular dystrophy and ectodermal dysplasia, ectrodactyly, and macular dystrophy syndrome (EEMS).
Anti-CDH3 antibody
STJ116448 100 µl
EUR 277
Description: This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. This gene is located in a gene cluster in a region on the long arm of chromosome 16 that is involved in loss of heterozygosity events in breast and prostate cancer. In addition, aberrant expression of this protein is observed in cervical adenocarcinomas. Mutations in this gene are associated with hypotrichosis with juvenile macular dystrophy and ectodermal dysplasia, ectrodactyly, and macular dystrophy syndrome (EEMS).
Rabbit Cadherin-3 (CDH3) ELISA Kit
abx363162-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
CDH3 siRNA
20-abx911222
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CDH3 siRNA
20-abx911223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CDH3
YF-PA27193 100 ul
EUR 403
Description: Rabbit polyclonal to CDH3
Cadherin 3 (CDH3) Antibody
20-abx306463
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
CDH3 Antibody, HRP conjugated
1-CSB-PA10715B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CDH3 Antibody, FITC conjugated
1-CSB-PA10715C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CDH3 Antibody, Biotin conjugated
1-CSB-PA10715D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDH3. Recognizes CDH3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CDH3 cloning plasmid
CSB-CL005052HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2490
  • Sequence: atggggctccctcgtggacctctcgcgtctctcctccttctccaggtttgctggctgcagtgcgcggcctccgagccgtgccgggcggtcttcagggaggctgaagtgaccttggaggcgggaggcgcggagcaggagcccggccaggcgctggggaaagtattcatgggctgcc
  • Show more
Description: A cloning plasmid for the CDH3 gene.
CDH3 cloning plasmid
CSB-CL005052HU2-10ug 10ug
EUR 769
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2355
  • Sequence: ATGGGGCTCCCTCGTGGACCTCTCGCGTCTCTCCTCCTTCTCCAGGTTTGCTGGCTGCAGTGCGCGGCCTCCGAGCCGTGCCGGGCGGTCTTCAGGGAGGCTGAAGTGACCTTGGAGGCGGGAGGCGCGGAGCAGGAGCCCGGCCAGGCGCTGGGGAAAGTATTCATGGGCTGCC
  • Show more
Description: A cloning plasmid for the CDH3 gene.
Cadherin-3/CDH3
E21-968 10ug
EUR 343
CDH3 Blocking Peptide
33R-1615 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDH3 antibody, catalog no. 70R-1708
CDH3 Blocking Peptide
DF3531-BP 1mg
EUR 195
P-Cadherin (CDH3) (12H6) Antibody
BNC551427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF555 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC551427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF555 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC551428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF555 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC551428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF555 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC611427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF660R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC611427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF660R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC611428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF660R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC611428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF660R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC401427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF640R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC401427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF640R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC401428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF640R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC401428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF640R conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC431427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF543 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC431427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF543 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC431428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF543 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC431428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF543 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC471427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF647 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC471427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF647 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC471428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF647 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC471428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF647 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC051427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF405M conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC051427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF405M conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC051428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF405M conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC051428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF405M conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC041427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF405S conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC041427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF405S conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC041428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF405S conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC041428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF405S conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNUB1427-100 100uL
EUR 209
Description: Primary antibody against P-Cadherin (CDH3) (12H6), Concentration: 0.2mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNUB1427-500 500uL
EUR 458
Description: Primary antibody against P-Cadherin (CDH3) (12H6), Concentration: 0.2mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNUB1428-100 100uL
EUR 209
Description: Primary antibody against P-Cadherin (CDH3) (6A9), Concentration: 0.2mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNUB1428-500 500uL
EUR 458
Description: Primary antibody against P-Cadherin (CDH3) (6A9), Concentration: 0.2mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNUM1427-50 50uL
EUR 395
Description: Primary antibody against P-Cadherin (CDH3) (12H6), 1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNUM1428-50 50uL
EUR 395
Description: Primary antibody against P-Cadherin (CDH3) (6A9), 1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC681427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF568 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC681427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF568 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC681428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF568 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC681428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF568 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC701427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF770 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC701427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF770 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC701428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF770 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC701428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF770 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC881427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF488A conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC881427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF488A conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC881428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF488A conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC881428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF488A conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC941427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF594 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC941427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF594 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC941428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF594 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC941428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF594 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCB1427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),Biotin conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCB1427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),Biotin conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCB1428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),Biotin conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCB1428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),Biotin conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCH1427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCH1427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCH1428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCH1428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC801427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF680 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNC801427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),CF680 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC801428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF680 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNC801428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),CF680 conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCP1427-250 250uL
EUR 383
Description: Primary antibody against P-Cadherin (CDH3) (12H6),PerCP conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCP1428-250 250uL
EUR 383
Description: Primary antibody against P-Cadherin (CDH3) (6A9),PerCP conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCR1427-250 250uL
EUR 383
Description: Primary antibody against P-Cadherin (CDH3) (12H6),RPE conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCR1428-250 250uL
EUR 383
Description: Primary antibody against P-Cadherin (CDH3) (6A9),RPE conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCA1427-250 250uL
EUR 383
Description: Primary antibody against P-Cadherin (CDH3) (12H6),APC conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCA1428-250 250uL
EUR 383
Description: Primary antibody against P-Cadherin (CDH3) (6A9),APC conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCAP1427-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (12H6),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (12H6) Antibody
BNCAP1427-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (12H6),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCAP1428-100 100uL
EUR 199
Description: Primary antibody against P-Cadherin (CDH3) (6A9),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
P-Cadherin (CDH3) (6A9) Antibody
BNCAP1428-500 500uL
EUR 544
Description: Primary antibody against P-Cadherin (CDH3) (6A9),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CDH3 Rabbit Polyclonal Antibody