PASK Rabbit Polyclonal Antibody

PASK Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

PASK Polyclonal Antibody
ES8957-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PASK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PASK Polyclonal Antibody
ABP59837-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
  • Applications tips:
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
PASK Polyclonal Antibody
ABP59837-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
  • Applications tips:
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
PASK Polyclonal Antibody
ABP59837-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
  • Applications tips:
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
PASK Polyclonal Antibody
A70035 100 ?g
EUR 628.55
Description: fast delivery possible
PASK Polyclonal Antibody
31656-100ul 100ul
EUR 252
PASK Polyclonal Antibody
31656-50ul 50ul
EUR 187
PASK Rabbit pAb
A8995-100ul 100 ul
EUR 308
PASK Rabbit pAb
A8995-200ul 200 ul
EUR 459
PASK Rabbit pAb
A8995-20ul 20 ul
EUR 183
PASK Rabbit pAb
A8995-50ul 50 ul
EUR 223
PASK Polyclonal Conjugated Antibody
C31656 100ul
EUR 397
PASK Antibody
ABD13196 100 ug
EUR 438
PASK antibody
22236-100ul 100ul
EUR 390
PASK antibody
10R-5159 100 ul
EUR 691
Description: Mouse monoclonal PASK antibody
PASK antibody
10R-5160 100 ul
EUR 691
Description: Mouse monoclonal PASK antibody
PASK antibody
10R-5161 100 ul
EUR 726
Description: Mouse monoclonal PASK antibody
PASK antibody
70R-13125 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PASK antibody
PASK Antibody
DF10342 200ul
EUR 304
Description: PASK Antibody detects endogenous levels of PASK.
PASK Antibody
1-CSB-PA822296LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500
PASK Polyclonal Antibody, HRP Conjugated
A70036 100 ?g
EUR 628.55
Description: reagents widely cited
PASK Polyclonal Antibody, FITC Conjugated
A70037 100 ?g
EUR 628.55
Description: Ask the seller for details
PASK Polyclonal Antibody, Biotin Conjugated
A70038 100 ?g
EUR 628.55
Description: The best epigenetics products
PASK (Phospho-Thr1165) Polyclonal Conjugated Antibody
C12526 100ul
EUR 397
anti- PASK antibody
FNab06165 100µg
EUR 505.25
  • Immunogen: PAS domain containing serine/threonine kinase
  • Uniprot ID: Q96RG2
  • Gene ID: 23178
  • Research Area: Signal Transduction
Description: Antibody raised against PASK
PASK (pT1165) Antibody
abx217647-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Anti-PASK antibody
PAab06165 100 ug
EUR 355
Anti-PASK antibody
STJ116338 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-PASK antibody
STJ190115 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PASK
PASK siRNA
20-abx927783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PASK siRNA
20-abx927784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PASK
YF-PA25847 50 ul
EUR 334
Description: Mouse polyclonal to PASK
Phospho-PASK (Thr1165) Antibody
AF8179 200ul
EUR 376
Description: PASK (Phospho-Thr1165) Antibody detects endogenous levels of PASK only when phosphorylated at Thr1165.
PASK (Phospho- Thr1165) Antibody
ABF8179 100 ug
EUR 438
PASK (Phospho-Thr1165) Antibody
12526-100ul 100ul
EUR 252
PASK (Phospho-Thr1165) Antibody
12526-50ul 50ul
EUR 187
PASK Antibody, HRP conjugated
1-CSB-PA822296LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PASK Antibody, FITC conjugated
1-CSB-PA822296LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PASK Antibody, Biotin conjugated
1-CSB-PA822296LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PASK Blocking Peptide
DF10342-BP 1mg
EUR 195
PASK cloning plasmid
CSB-CL822296HU1-10ug 10ug
EUR 1393
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3972
  • Sequence: atggaggacgggggcttaacagcctttgaagaggaccagagatgcctttcccagagcctccccttgccagtgtcagcagagggcccagctgcacagaccactgctgagcccagcaggtcgttttcctcagcccacagacacctgagcagaaggaatgggctttccagactctgcc
  • Show more
Description: A cloning plasmid for the PASK gene.
PASK cloning plasmid
CSB-CL822296HU2-10ug 10ug
EUR 1218
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3432
  • Sequence: ATGGAGGACGGGGGCTTAACAGCCTTTGAAGAGGACCAGAGATGCCTTTCCCAGAGCCTCCCCTTGCCAGTGTCAGCAGAGGGCCCAGCTGCACAGACCACTGCTGAGCCCAGCAGGTCGTTTTCCTCAGCCCACAGACACCTGAGCAGAAGGAATGGGCTTTCCAGACTCTGCC
  • Show more
Description: A cloning plasmid for the PASK gene.
pASK- IBA5plus++FUS
PVT10149 2 ug
EUR 266
Anti-PASK (6D10)
YF-MA17817 100 ug
EUR 363
Description: Mouse monoclonal to PASK
Anti-PASK (6B7)
YF-MA17818 200 ul
EUR 363
Description: Mouse monoclonal to PASK
Mouse PASK shRNA Plasmid
20-abx983023
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PASK ELISA KIT|Human
EF001573 96 Tests
EUR 689
Mouse Pask ELISA KIT
ELI-45065m 96 Tests
EUR 865
Human PASK ELISA KIT
ELI-37789h 96 Tests
EUR 824
Human PASK shRNA Plasmid
20-abx958061
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Monoclonal PASK Antibody (monoclonal) (M01), Clone: 6D10
APR17759G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PASK (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6D10. This antibody is applicable in WB, E
Phospho-PASK (Thr1165) Blocking Peptide
AF8179-BP 1mg
EUR 195
PASK ORF Vector (Human) (pORF)
ORF007540 1.0 ug DNA
EUR 95
Pask ORF Vector (Rat) (pORF)
ORF073123 1.0 ug DNA
EUR 2080
PASK ORF Vector (Human) (pORF)
ORF014012 1.0 ug DNA
EUR 354
Pask ORF Vector (Mouse) (pORF)
ORF053411 1.0 ug DNA
EUR 1572
PASK sgRNA CRISPR Lentivector set (Human)
K1597401 3 x 1.0 ug
EUR 339
Pask sgRNA CRISPR Lentivector set (Rat)
K7437501 3 x 1.0 ug
EUR 339
Pask sgRNA CRISPR Lentivector set (Mouse)
K3907201 3 x 1.0 ug
EUR 339
PAS Domain-Containing Serine/threonine-Protein Kinase (PASK) Antibody
20-abx124562
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
PAS Domain-Containing Serine/threonine-Protein Kinase (PASK) Antibody
abx340054-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
PAS domain-containing serine/threonine-protein kinase (PASK) Antibody
20-abx333731
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PAS Domain-Containing Serine/threonine-Protein Kinase (PASK) Antibody
abx236165-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
PASK sgRNA CRISPR Lentivector (Human) (Target 1)
K1597402 1.0 ug DNA
EUR 154
PASK sgRNA CRISPR Lentivector (Human) (Target 2)
K1597403 1.0 ug DNA
EUR 154
PASK sgRNA CRISPR Lentivector (Human) (Target 3)
K1597404 1.0 ug DNA
EUR 154
Pask sgRNA CRISPR Lentivector (Rat) (Target 1)
K7437502 1.0 ug DNA
EUR 154
Pask sgRNA CRISPR Lentivector (Rat) (Target 2)
K7437503 1.0 ug DNA
EUR 154
Pask sgRNA CRISPR Lentivector (Rat) (Target 3)
K7437504 1.0 ug DNA
EUR 154
Pask sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3907202 1.0 ug DNA
EUR 154
Pask sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3907203 1.0 ug DNA
EUR 154
Pask sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3907204 1.0 ug DNA
EUR 154
PASK Protein Vector (Human) (pPB-C-His)
PV056045 500 ng
EUR 481
PASK Protein Vector (Human) (pPB-N-His)
PV056046 500 ng
EUR 481
PASK Protein Vector (Human) (pPM-C-HA)
PV056047 500 ng
EUR 481
PASK Protein Vector (Human) (pPM-C-His)
PV056048 500 ng
EUR 481
PASK Protein Vector (Human) (pPB-C-His)
PV030157 500 ng
EUR 329
PASK Protein Vector (Human) (pPB-N-His)
PV030158 500 ng
EUR 329
PASK Protein Vector (Human) (pPM-C-HA)
PV030159 500 ng
EUR 329
PASK Protein Vector (Human) (pPM-C-His)
PV030160 500 ng
EUR 329
PASK Protein Vector (Mouse) (pPB-C-His)
PV213642 500 ng
EUR 2360
PASK Protein Vector (Mouse) (pPB-N-His)
PV213643 500 ng
EUR 2360
PASK Protein Vector (Mouse) (pPM-C-HA)
PV213644 500 ng
EUR 2360
PASK Protein Vector (Mouse) (pPM-C-His)
PV213645 500 ng
EUR 2360
PASK Protein Vector (Rat) (pPB-C-His)
PV292490 500 ng
EUR 2363
PASK Protein Vector (Rat) (pPB-N-His)
PV292491 500 ng
EUR 2363
PASK Protein Vector (Rat) (pPM-C-HA)
PV292492 500 ng
EUR 2363
PASK Protein Vector (Rat) (pPM-C-His)
PV292493 500 ng
EUR 2363
Pask 3'UTR GFP Stable Cell Line
TU165931 1.0 ml Ask for price
PASK 3'UTR Luciferase Stable Cell Line
TU017428 1.0 ml
EUR 1521
Pask 3'UTR Luciferase Stable Cell Line
TU115931 1.0 ml Ask for price
PASK 3'UTR GFP Stable Cell Line
TU067428 1.0 ml
EUR 1521
Pask 3'UTR GFP Stable Cell Line
TU265834 1.0 ml Ask for price
Pask 3'UTR Luciferase Stable Cell Line
TU215834 1.0 ml Ask for price
PAS domain-containing serine/threonine-protein kinase (PASK) Antibody (HRP)
20-abx336940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PAS domain-containing serine/threonine-protein kinase (PASK) Antibody (FITC)
20-abx336941
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PAS domain-containing serine/threonine-protein kinase (PASK) Antibody (Biotin)
20-abx336942
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PASK Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV658501 1.0 ug DNA
EUR 2211
PASK Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV658505 1.0 ug DNA
EUR 2211
PASK Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV658506 1.0 ug DNA
EUR 2211
PASK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704505 1.0 ug DNA
EUR 450
PASK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704509 1.0 ug DNA
EUR 450
PASK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV704510 1.0 ug DNA
EUR 450
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PASK Rabbit Polyclonal Antibody