CD22 Rabbit Polyclonal Antibody

CD22 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CD22 Polyclonal Antibody
ES8813-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD22 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD22 Polyclonal Antibody
ABP57025-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human CD22 around the non-phosphorylation site of Y807
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 from Human. This CD22 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD22 around the non-phosphorylation site of Y807

CD22 Polyclonal Antibody
ABP57025-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human CD22 around the non-phosphorylation site of Y807
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 from Human. This CD22 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD22 around the non-phosphorylation site of Y807

CD22 Polyclonal Antibody
ABP57025-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human CD22 around the non-phosphorylation site of Y807
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 from Human. This CD22 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD22 around the non-phosphorylation site of Y807

CD22 Polyclonal Antibody
ABP58046-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CD22 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 from Human. This CD22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD22 protein at amino acid sequence of 780-860

CD22 Polyclonal Antibody
ABP58046-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD22 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 from Human. This CD22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD22 protein at amino acid sequence of 780-860

CD22 Polyclonal Antibody
ABP58046-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD22 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 from Human. This CD22 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD22 protein at amino acid sequence of 780-860

CD22 Polyclonal Antibody
46886-100ul 100ul
EUR 252

CD22 Polyclonal Antibody
46886-50ul 50ul
EUR 187

CD22 Rabbit pAb
A5790-100ul 100 ul
EUR 308

CD22 Rabbit pAb
A5790-200ul 200 ul
EUR 459

CD22 Rabbit pAb
A5790-20ul 20 ul
EUR 183

CD22 Rabbit pAb
A5790-50ul 50 ul
EUR 223

CD22 (phospho Tyr807) Polyclonal Antibody
ES8023-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD22 (phospho Tyr807) from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD22 (phospho Tyr807) Polyclonal Antibody
ES8023-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD22 (phospho Tyr807) from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD22 (phospho Tyr807) Polyclonal Antibody
ABP57024-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human CD22 around the phosphorylation site of Y807
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 phospho Tyr807) from Human. This CD22 phospho Tyr807) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD22 around the phosphorylation site of Y807

CD22 (phospho Tyr807) Polyclonal Antibody
ABP57024-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human CD22 around the phosphorylation site of Y807
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 phospho Tyr807) from Human. This CD22 phospho Tyr807) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD22 around the phosphorylation site of Y807

CD22 (phospho Tyr807) Polyclonal Antibody
ABP57024-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human CD22 around the phosphorylation site of Y807
  • Applications tips:
Description: A polyclonal antibody for detection of CD22 phospho Tyr807) from Human. This CD22 phospho Tyr807) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD22 around the phosphorylation site of Y807

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

CD22 antibody
70R-9913 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CD22 antibody

CD22 antibody
70R-9914 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CD22 antibody

CD22 antibody
70R-CR021 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal CD22 antibody

CD22 Antibody
ABD7646 100 ug
EUR 438

CD22 Antibody
ABD7647 100 ug
EUR 438

CD22 Antibody
ABD7648 100 ug
EUR 438

CD22 Antibody
ABD7651 100 ug
EUR 438

CD22 Antibody
ABD7665 100 ug
EUR 438

CD22 antibody
10-2485 250 ug
EUR 492
Description: Mouse monoclonal CD22 antibody

CD22 antibody
10-2486 250 ug
EUR 492
Description: Mouse monoclonal CD22 antibody

CD22 antibody
10-2487 250 ug
EUR 492
Description: Mouse monoclonal CD22 antibody

CD22 antibody
10R-CD22cMS 500 ug
EUR 457
Description: Rat monoclonal CD22 antibody

CD22 Antibody
33045-100ul 100ul
EUR 252

CD22 Antibody
21492-100ul 100ul
EUR 252

CD22 Antibody
21492-50ul 50ul
EUR 187

CD22 antibody
20R-1528 100 ug
EUR 673
Description: Rabbit polyclonal CD22 antibody

CD22 antibody
20R-2730 50 ug
EUR 281
Description: Rabbit polyclonal CD22 antibody

CD22 antibody
70R-13701 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CD22 antibody

CD22 Antibody
DF7646 200ul
EUR 304
Description: CD22 Antibody detects endogenous levels of total CD22.

CD22 Antibody
1-CSB-PA004900ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD22. Recognizes CD22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD22 Antibody
CSB-PA828492-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CD22. Recognizes CD22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CD22 Antibody
CSB-PA828492-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CD22. Recognizes CD22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CD22 Antibody
1-CSB-PA616669
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD22. Recognizes CD22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CD22 Antibody
1-CSB-PA576542
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD22. Recognizes CD22 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CD22 Antibody
1-CSB-PA070294
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD22. Recognizes CD22 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

CD22 Antibody
P1034-01m 0.1m
EUR 202

CD22 Antibody
P1034-1ml 1ml
EUR 861

CD22 antibody
PAab10004 100 ug
EUR 386

B-cell Receptor CD22 (CD22) Antibody
abx139202-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

B-cell Receptor CD22 (CD22) Antibody
abx139203-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

B-cell Receptor CD22 (CD22) Antibody
abx146206-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
abx149067-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
20-abx134568
  • EUR 356.00
  • EUR 565.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
20-abx134569
  • EUR 356.00
  • EUR 565.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
20-abx004435
  • EUR 411.00
  • EUR 105.00
  • EUR 592.00
  • EUR 182.00
  • 100 ul
  • 10 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-Cell Receptor CD22 (CD22) Antibody
abx016089-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
20-abx323839
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
20-abx320183
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-Cell Receptor CD22 (CD22) Antibody
abx224015-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
abx330485-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
abx330695-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
abx413804-025mg 0.25 mg
EUR 565
  • Shipped within 1 week.

B-cell Receptor CD22 (CD22) Antibody
abx413806-025mg 0.25 mg
EUR 565
  • Shipped within 1 week.

B-cell Receptor CD22 (CD22) Antibody
abx414050-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

B-cell Receptor CD22 (CD22) Antibody
20-abx210775
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
20-abx210776
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
abx200186-100ug 100 ug
EUR 328
  • Shipped within 2-3 weeks.

B-cell Receptor CD22 (CD22) Antibody
20-abx225086
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody
abx231444-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-CD22/Siglec 2 Rabbit Monoclonal Antibody
M01572-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD22/Siglec 2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

CD22
22A-100T 100 test
EUR 349

CD22
22CFB-100T 100 test
EUR 388

CD22
22F-100T 100 test
EUR 297

CD22
22PE-100T 100 test
EUR 349

CD22
22PP5.5-100T
EUR 888.5

CD22
22PU-01MG 0,1 mg
EUR 219

CD22
PR27301 5 ug
EUR 318

B-cell Receptor CD22 (CD22) Antibody (PE)
abx139204-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

B-cell Receptor CD22 (CD22) Antibody (APC)
abx139205-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

B-cell Receptor CD22 (CD22) Antibody (PE)
abx139207-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

B-Cell Receptor CD22 (CD22) Antibody (FITC)
abx134565-100Assays 100 Assays
EUR 439
  • Shipped within 5-10 working days.

B-Cell Receptor CD22 (CD22) Antibody (FITC)
abx134565-50Assays 50 Assays
EUR 342
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody (PE)
abx134566-100Assays 100 Assays
EUR 495
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody (PE)
abx134566-50Assays 50 Assays
EUR 398
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody (PE)
abx134567-100Assays 100 Assays
EUR 495
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody (PE)
abx134567-50Assays 50 Assays
EUR 398
  • Shipped within 5-10 working days.

CD22 Molecule Phospho-Tyr807 (CD22 pY807) Antibody
20-abx324578
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

B-cell Receptor CD22 (CD22) Antibody (FITC)
abx413805-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

B-cell Receptor CD22 (CD22) Antibody (FITC)
abx413807-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

B-cell Receptor CD22 (CD22) Antibody (RPE)
abx413808-100tests 100 tests
EUR 592
  • Shipped within 1 week.

B-cell Receptor CD22 (CD22) Antibody (RPE)
abx414051-100tests 100 tests
EUR 592
  • Shipped within 1 week.

B-Cell Receptor CD22 (CD22) Antibody (FITC)
abx200187-100tests 100 tests
EUR 398
  • Shipped within 3-5 working days.

B-cell Receptor CD22 (CD22) Antibody (PE)
abx200188-100tests 100 tests
EUR 453
  • Shipped within 3-5 working days.

B-cell Receptor CD22 (CD22) Antibody (APC)
abx200189-100tests 100 tests
EUR 453
  • Shipped within 3-5 working days.

CD22(FR10B4) Antibody
BNC610358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF660R conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC610358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF660R conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC610974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF660R conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC610974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF660R conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC680358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF568 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC680358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF568 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC400358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF640R conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC400358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF640R conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC400974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF640R conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC400974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF640R conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC430358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF543 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC430358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF543 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC430974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF543 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC430974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF543 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC470974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF647 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC470974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF647 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC550358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF555 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC550358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF555 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC550974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF555 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC550974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF555 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC040358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF405S conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC040358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF405S conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC050358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF405M conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC050358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF405M conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC050974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF405M conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC050974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF405M conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC040974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF405S conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC040974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF405S conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC470358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF647 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC470358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF647 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNUB0974-100 100uL
EUR 209
Description: Primary antibody against CD22(Myg13), Concentration: 0.2mg/mL

CD22(Myg13) Antibody
BNUB0974-500 500uL
EUR 458
Description: Primary antibody against CD22(Myg13), Concentration: 0.2mg/mL

CD22(FR10B4) Antibody
BNUM0358-50 50uL
EUR 395
Description: Primary antibody against CD22(FR10B4), 1mg/mL

CD22(Myg13) Antibody
BNUM0974-50 50uL
EUR 395
Description: Primary antibody against CD22(Myg13), 1mg/mL

CD22(Myg13) Antibody
BNC680974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF568 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC680974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF568 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC700358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF770 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC700358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF770 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC700974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF770 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC700974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF770 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC940358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF594 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC940358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF594 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC940974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF594 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC940974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF594 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCH0358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCH0358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCH0974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCH0974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC800358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF680 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC800358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF680 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC800974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF680 conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC800974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF680 conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC810358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF680R conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC810358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF680R conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCP0358-250 250uL
EUR 383
Description: Primary antibody against CD22(FR10B4), PerCP conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCP0974-250 250uL
EUR 383
Description: Primary antibody against CD22(Myg13), PerCP conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCR0358-250 250uL
EUR 383
Description: Primary antibody against CD22(FR10B4), RPE conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCR0974-250 250uL
EUR 383
Description: Primary antibody against CD22(Myg13), RPE conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCA0358-250 250uL
EUR 383
Description: Primary antibody against CD22(FR10B4), APC conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCA0974-250 250uL
EUR 383
Description: Primary antibody against CD22(Myg13), APC conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCAP0358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCAP0358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCAP0974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCAP0974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCB0358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), Biotin conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNCB0358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), Biotin conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCB0974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), Biotin conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNCB0974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), Biotin conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC880358-100 100uL
EUR 199
Description: Primary antibody against CD22(FR10B4), CF488A conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNC880358-500 500uL
EUR 544
Description: Primary antibody against CD22(FR10B4), CF488A conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC880974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF488A conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC880974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF488A conjugate, Concentration: 0.1mg/mL

CD22(FR10B4) Antibody
BNUB0358-100 100uL
EUR 209
Description: Primary antibody against CD22(FR10B4), Concentration: 0.2mg/mL

CD22(FR10B4) Antibody
BNUB0358-500 500uL
EUR 458
Description: Primary antibody against CD22(FR10B4), Concentration: 0.2mg/mL

CD22(Myg13) Antibody
BNC810974-100 100uL
EUR 199
Description: Primary antibody against CD22(Myg13), CF680R conjugate, Concentration: 0.1mg/mL

CD22(Myg13) Antibody
BNC810974-500 500uL
EUR 544
Description: Primary antibody against CD22(Myg13), CF680R conjugate, Concentration: 0.1mg/mL

anti- CD22 antibody
FNab01444 100µg
EUR 505.25
  • Recommended dilution: WB : 1:1000-1:10000IHC : 1:200-1:800
  • Immunogen: CD22 molecule
  • Uniprot ID: P20273
  • Gene ID: 933
  • Research Area: Stem Cells, Immunology, Signal Transduction, Cancer
Description: Antibody raised against CD22

anti- CD22 antibody
FNab10004 100µg
EUR 548.75
  • Recommended dilution: WB : 1:500-1:2000
  • Immunogen: CD22 molecule
  • Uniprot ID: P20273
  • Gene ID: 933
  • Research Area: Stem Cells, Immunology, Signal Transduction, Cancer
Description: Antibody raised against CD22

CD22 Antibody (FITC)
abx139206-100tests 100 tests
EUR 425
  • Shipped within 5-12 working days.

CD22 Antibody (Biotin)
abx139208-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.

CD22 (pY807) Antibody
abx332946-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

CD22 antibody (Allophycocyanin)
61R-CD22cMSAPC 100 ug
EUR 370
Description: Rat monoclonal CD22 antibody (Allophycocyanin)

CD22 antibody (biotin)
61R-CD22cMSBT 500 ug
EUR 457
Description: Rat monoclonal CD22 antibody (biotin)

CD22 antibody (FITC)
61R-CD22cMSFT 500 ug
EUR 457
Description: Rat monoclonal CD22 antibody (FITC)

CD22 antibody (PE)
61R-CD22cMSPE 100 ug
EUR 295
Description: Rat monoclonal CD22 antibody (PE)

Anti-CD22 Antibody
PB9691 100ug/vial
EUR 334

Anti-CD22 Antibody
PA1018 100ug/vial
EUR 334

Anti-CD22 Antibody
PA1018-1 100ug/vial
EUR 334

Anti-CD22 antibody
STJ92105 200 µl
EUR 197
Description: Rabbit polyclonal to CD22.

Anti-CD22 antibody
STJ98831 200 µl
EUR 197
Description: Rabbit polyclonal to Rb (Acetyl-K873/K874).

Anti-CD22 antibody
STJ28354 100 µl
EUR 277

Anti-CD22 antibody
STJ16100031 0.5 mL
EUR 480

Anti-CD22 antibody
STJ16100032 0.5 mL
EUR 541

Anti-CD22 antibody
STJ16101098 100 µg
EUR 354

Anti-CD22 antibody
STJ180373 0.1 ml
EUR 218

B-cell Receptor CD22 (CD22) Antibody (CF-Blue)
abx200190-100tests 100 tests
EUR 481
  • Shipped within 3-5 working days.

Human B-cell receptor CD22 (CD22)
1-CSB-MP004900HU
  • EUR 273.00
  • EUR 877.00
  • EUR 378.00
  • EUR 655.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 79.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human B-cell receptor CD22(CD22),partial expressed in Mammalian cell

CD22 antibody (Azide Free)
10R-CD22cMSP 500 ug
EUR 565
Description: Rat monoclonal CD22 antibody (Azide Free)

CD22 antibody (Spectral Red)
61R-CD22cMSSP 100 ug
EUR 370
Description: Rat monoclonal CD22 antibody (Spectral Red)

Phospho-CD22 (Tyr807) Antibody
CSB-PA912726-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CD22 (Tyr807). Recognizes Phospho-CD22 (Tyr807) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CD22 (Tyr807) Antibody
CSB-PA912726-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CD22 (Tyr807). Recognizes Phospho-CD22 (Tyr807) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CD22 (Ab-807) Antibody
CSB-PA953915-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CD22 (Ab-807). Recognizes CD22 (Ab-807) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CD22 (Ab-807) Antibody
CSB-PA953915-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CD22 (Ab-807). Recognizes CD22 (Ab-807) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-CD22 (Y807) Antibody
1-CSB-PA070293
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CD22 (Y807). Recognizes Phospho-CD22 (Y807) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

CD22 siRNA
20-abx910968
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD22 siRNA
20-abx910969
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD22 protein
30R-ACD22 20 ug
EUR 273
Description: Purified recombinant Human CD22 protein

MPO/CD22
MPOF22PE-50T 50 test
EUR 436.1

Rabbit B-cell receptor CD22 ELISA kit
E04B0880-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B-cell receptor CD22 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit B-cell receptor CD22 ELISA kit
E04B0880-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B-cell receptor CD22 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit B-cell receptor CD22 ELISA kit
E04B0880-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B-cell receptor CD22 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal CD22 Antibody, Clone: 2H1C4
APG02483G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CD22. The antibodies are raised in Mouse and are from clone 2H1C4. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal CD22 Antibody, Clone: 1A3A11
APR15340G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CD22. The antibodies are raised in Mouse and are from clone 1A3A11. This antibody is applicable in WB, FC, ICC, E

MPO / CD22 Antibody (FITC, PE)
abx200612-50tests 50 tests
EUR 495
  • Shipped within 3-5 working days.

Anti-CD22 Antibody (monoclonal, 5E7)
M01572-2 100ug/vial
EUR 294

Anti-Phospho-CD22 (Y807) antibody
STJ90608 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-CD22 (Y807).

Anti-CD22/B-cells antibody
STJ16100034 100 µg
EUR 406

Mouse Cd22/ B-cell receptor CD22 ELISA Kit
E1622Mo 1 Kit
EUR 571

Human CD22/ B-cell receptor CD22 ELISA Kit
E2753Hu 1 Kit
EUR 571

Mouse B- cell receptor CD22, Cd22 ELISA KIT
ELI-04994m 96 Tests
EUR 865

Human B- cell receptor CD22, CD22 ELISA KIT
ELI-04995h 96 Tests
EUR 824

CD22 cloning plasmid
CSB-CL004900HU-10ug 10ug
EUR 678
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2028
  • Sequence: ATGTCTCTGTGGCTCCTAGAGGGGGTTCCAATGAGGCAGGCTGCTGTCACCTCGACCTCCTTGACCATCAAGTCTGTCTTCACCCGGAGCGAGCTCAAGTTCTCCCCACAGTGGAGTCACCATGGGAAGATTGTGACCTGCCAGCTTCAGGATGCAGATGGGAAGTTCCTCTCCA
  • Show more
Description: A cloning plasmid for the CD22 gene.

CD22 Blocking Peptide
33R-10236 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD22 antibody, catalog no. 70R-9913

CD22 Blocking Peptide
33R-9398 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD22 antibody, catalog no. 70R-9914

CD103/ CD22/ CD20
103F22PE20PP2-50T 50 test
EUR 700

CD22 Blocking Peptide
DF7646-BP 1mg
EUR 195

pDONR223-CD22 Plasmid
PVTB00779 2 ug
EUR 356

pCDNA3.1-CD22 Plasmid
PVT16104 2 ug
EUR 325

Rabbit cluster of differentiation 22(CD22) ELISA kit
E04C1471-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 22(CD22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 22(CD22) ELISA kit
E04C1471-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 22(CD22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 22(CD22) ELISA kit
E04C1471-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 22(CD22) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human B-Cell Receptor CD22 / SIGLEC2 (CD22) ELISA Kit
abx517655-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse B-Cell Receptor CD22 / SIGLEC2 (CD22) ELISA Kit
abx517656-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Anti Mouse Cd22 Monoclonal Antibody
CABT-45762RM 0.25 mg
EUR 663

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC551795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF555 conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC551795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF555 conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC611795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF660R conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC611795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF660R conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC401795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF640R conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC401795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF640R conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC431795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF543 conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC431795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF543 conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC471795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF647 conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC471795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF647 conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC051795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF405M conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC051795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF405M conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC041795-100 100uL
EUR 199
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF405S conjugate, Concentration: 0.1mg/mL

CD22 / BL-CAM (BLCAM/1795) Antibody
BNC041795-500 500uL
EUR 544
Description: Primary antibody against CD22 / BL-CAM (BLCAM/1795),CF405S conjugate, Concentration: 0.1mg/mL

CD22 Rabbit Polyclonal Antibody

 

Apex Business WordPress Theme | Designed by Crafthemes