ATG10 Rabbit Polyclonal Antibody

ATG10 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

ATG10 Polyclonal Antibody
46882-50ul 50ul
EUR 187
ATG10 Polyclonal Antibody
A67182 100 µg
EUR 570.55
Description: Ask the seller for details
ATG10 Polyclonal Antibody
ABP57837-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
ATG10 Polyclonal Antibody
ABP57837-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
ATG10 Polyclonal Antibody
ABP57837-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50
ATG10 Polyclonal Antibody
ES8763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG10 from Human. This antibody is tested and validated for IHC, WB, ELISA
ATG10 Polyclonal Antibody
ES8763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG10 from Human. This antibody is tested and validated for IHC, WB, ELISA
ATG10 Rabbit pAb
A7390-100ul 100 ul
EUR 308
ATG10 Rabbit pAb
A7390-200ul 200 ul
EUR 459
ATG10 Rabbit pAb
A7390-20ul 20 ul
EUR 183
ATG10 Rabbit pAb
A7390-50ul 50 ul
EUR 223
Polyclonal APG10/ATG10 Antibody
APR00221G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APG10/ATG10 . This antibody is tested and proven to work in the following applications:
ATG10 Polyclonal Conjugated Antibody
C46882 100ul
EUR 397
ATG10 Antibody
24607-100ul 100ul
EUR 390
ATG10 antibody
70R-12183 100 ug
EUR 447
Description: Rabbit polyclonal ATG10 antibody
ATG10 Antibody
36115-100ul 100ul
EUR 252
ATG10 Antibody
1-CSB-PA828297
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
ATG10 Antibody
1-CSB-PA861988ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ATG10 Antibody
1-CSB-PA861988LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
ATG10 Antibody
DF8366 200ul
EUR 304
Description: ATG10 Antibody detects endogenous levels of total ATG10.
ATG10 Antibody
1-CSB-PA167980
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
ATG10 antibody
70R-3584 50 ug
EUR 467
Description: Rabbit polyclonal ATG10 antibody
ATG10 Antibody
ABD8366 100 ug
EUR 438
Polyclonal ATG10 Antibody (N-term)
APR07066G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG10 (N-term). This antibody is tested and proven to work in the following applications:
ATG10 Polyclonal Antibody, HRP Conjugated
A67183 100 µg
EUR 570.55
Description: The best epigenetics products
ATG10 Polyclonal Antibody, FITC Conjugated
A67184 100 µg
EUR 570.55
Description: kits suitable for this type of research
ATG10 Polyclonal Antibody, Biotin Conjugated
A67185 100 µg
EUR 570.55
Description: fast delivery possible
Anti-Apg10 (Atg10) Rabbit Monoclonal Antibody
M07803 100ug/vial
EUR 397
Description: Rabbit Monoclonal Apg10 (Atg10) Antibody. Validated in IP, WB and tested in Human.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx006473
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx320319
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
abx448529-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx310646
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx225049
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human ATG10 Antibody
32244-05111 150 ug
EUR 261
APG10/ATG10 Antibody
3910-100
EUR 338
ATG10 Conjugated Antibody
C36115 100ul
EUR 397
ATG10 Antibody (Biotin)
abx447701-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
ATG10 Antibody (FITC)
abx447702-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
ATG10 Antibody (HRP)
abx447703-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Anti-ATG10 antibody
STJ29527 100 µl
EUR 277
Anti-ATG10 antibody
STJ98826 200 µl
EUR 197
Description: Rabbit polyclonal to ATG10.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ALP)
abx447699-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (APC)
abx447700-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PerCP)
abx447705-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (RPE)
abx447706-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (Streptavidin)
abx447707-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
ATG10 siRNA
20-abx908442
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ATG10 siRNA
20-abx908443
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 390)
abx447691-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 488)
abx447692-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 565)
abx447693-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 594)
abx447694-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 633)
abx447695-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 655)
abx447696-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 680)
abx447697-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 700)
abx447698-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
ATG10 Antibody, HRP conjugated
1-CSB-PA861988LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ATG10 Antibody, FITC conjugated
1-CSB-PA861988LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ATG10 Antibody, Biotin conjugated
1-CSB-PA861988LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Antibody for Human ATG10
SPC-669D 0.1mg
EUR 354
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated.
Antibody for Human ATG10
SPC-669D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 390.
Antibody for Human ATG10
SPC-669D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 488.
Antibody for Human ATG10
SPC-669D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 565.
Antibody for Human ATG10
SPC-669D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 594.
Antibody for Human ATG10
SPC-669D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 633.
Antibody for Human ATG10
SPC-669D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 655.
Antibody for Human ATG10
SPC-669D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 680.
Antibody for Human ATG10
SPC-669D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 700.
Antibody for Human ATG10
SPC-669D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human ATG10
SPC-669D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC .
Antibody for Human ATG10
SPC-669D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC/Cy7.
Antibody for Human ATG10
SPC-669D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Biotin.
Antibody for Human ATG10
SPC-669D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 350.
Antibody for Human ATG10
SPC-669D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 405.
Antibody for Human ATG10
SPC-669D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 488.
Antibody for Human ATG10
SPC-669D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 594.
Antibody for Human ATG10
SPC-669D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 633.
Antibody for Human ATG10
SPC-669D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to FITC.
Antibody for Human ATG10
SPC-669D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to HRP.
Antibody for Human ATG10
SPC-669D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PE/ATTO 594.
Antibody for Human ATG10
SPC-669D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PerCP.
Antibody for Human ATG10
SPC-669D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to RPE .
Antibody for Human ATG10
SPC-669D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Streptavidin.
Antibody for Human ATG10
SPC-669S 0.012mg
EUR 65
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated.
Human Ubiquitin-like-conjugating enzyme ATG10 (ATG10)
1-CSB-EP861988HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-like-conjugating enzyme ATG10(ATG10) expressed in E.coli
Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PE/ATTO 594)
abx447704-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.
ATG10 Blocking Peptide
33R-9235 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG10 antibody, catalog no. 70R-3584
ATG10 Blocking Peptide
DF8366-BP 1mg
EUR 195
ATG10 cloning plasmid
CSB-CL861988HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatctaggagcatctac
  • Show more
Description: A cloning plasmid for the ATG10 gene.
ATG10 cloning plasmid
CSB-CL861988HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 663
  • Sequence: atggaagaagatgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacagataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatct
  • Show more
Description: A cloning plasmid for the ATG10 gene.
Human ATG10 Antibody (Biotin Conjugate)
32244-05121 150 ug
EUR 369
Autophagy Related 10 (ATG10) Antibody
20-abx211898
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Autophagy Related 10 (ATG10) Antibody
20-abx211899
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Apg10 (Atg10) recombinant monoclonal antibody
A5711 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Apg10 (Atg10) for WB ,ELISA
Mouse Ubiquitin- like- conjugating enzyme ATG10, Atg10 ELISA KIT
ELI-24028m 96 Tests
EUR 865
Human Ubiquitin- like- conjugating enzyme ATG10, ATG10 ELISA KIT
ELI-34706h 96 Tests
EUR 824
Human ATG10 AssayLite Antibody (FITC Conjugate)
32244-05141 150 ug
EUR 428
Human ATG10 AssayLite Antibody (RPE Conjugate)
32244-05151 150 ug
EUR 428
Human ATG10 AssayLite Antibody (APC Conjugate)
32244-05161 150 ug
EUR 428
Human ATG10 AssayLite Antibody (PerCP Conjugate)
32244-05171 150 ug
EUR 471
Autophagy Related 10 (ATG10) Antibody (HRP)
20-abx310647
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Autophagy Related 10 (ATG10) Antibody (FITC)
20-abx310648
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Autophagy Related 10 (ATG10) Antibody (Biotin)
20-abx310649
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ATG10 protein (His tag)
80R-2494 100 ug
EUR 322
Description: Purified recombinant ATG10 protein (His tag)
Mouse ATG10 shRNA Plasmid
20-abx975785
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ATG10 shRNA Plasmid
20-abx963181
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pCMV-Myc-ATG10 Plasmid
PVTB00420-2a 2 ug
EUR 356
pCMV-SPORT6-ATG10 Plasmid
PVT16512 2 ug
EUR 325
ATG10 Recombinant Protein (Human)
RP002188 100 ug Ask for price
ATG10 Recombinant Protein (Human)
RP002191 100 ug Ask for price
ATG10 Recombinant Protein (Mouse)
RP117734 100 ug Ask for price
ATG10 Recombinant Protein (Rat)
RP191300 100 ug Ask for price
Atg10 ORF Vector (Rat) (pORF)
ORF063768 1.0 ug DNA
EUR 506
ATG10 ORF Vector (Human) (pORF)
ORF000730 1.0 ug DNA
EUR 95
ATG10 ORF Vector (Human) (pORF)
ORF000731 1.0 ug DNA
EUR 95
Atg10 ORF Vector (Mouse) (pORF)
ORF039246 1.0 ug DNA
EUR 506
Atg10 sgRNA CRISPR Lentivector set (Mouse)
K4763001 3 x 1.0 ug
EUR 339
Atg10 sgRNA CRISPR Lentivector set (Rat)
K6746201 3 x 1.0 ug
EUR 339
ATG10 sgRNA CRISPR Lentivector set (Human)
K0142801 3 x 1.0 ug
EUR 339
ATG10-AS1 ORF Vector (Human) (pORF)
ORF015904 1.0 ug DNA Ask for price
ATG10-IT1 ORF Vector (Human) (pORF)
ORF015905 1.0 ug DNA Ask for price
Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4763002 1.0 ug DNA
EUR 154
Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4763003 1.0 ug DNA
EUR 154
Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4763004 1.0 ug DNA
EUR 154
Atg10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6746202 1.0 ug DNA
EUR 154
Atg10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6746203 1.0 ug DNA
EUR 154
Atg10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6746204 1.0 ug DNA
EUR 154
ATG10 sgRNA CRISPR Lentivector (Human) (Target 1)
K0142802 1.0 ug DNA
EUR 154
ATG10 sgRNA CRISPR Lentivector (Human) (Target 2)
K0142803 1.0 ug DNA
EUR 154
ATG10 sgRNA CRISPR Lentivector (Human) (Target 3)
K0142804 1.0 ug DNA
EUR 154
ATG10 Autophagy Related 10 Human Recombinant Protein
PROTQ9H0Y0 Regular: 20ug
EUR 317
Description: ATG10 Human Recombinant produced in E. coli is a single polypeptide chain containing 243 amino acids (1-220) and having a molecular mass of 27.7 kDa.;ATG10 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
ATG10 Protein Vector (Mouse) (pPB-C-His)
PV156982 500 ng
EUR 603
ATG10 Protein Vector (Mouse) (pPB-N-His)
PV156983 500 ng
EUR 603
ATG10 Protein Vector (Mouse) (pPM-C-HA)
PV156984 500 ng
EUR 603
ATG10 Protein Vector (Mouse) (pPM-C-His)
PV156985 500 ng
EUR 603
ATG10 Protein Vector (Rat) (pPB-C-His)
PV255070 500 ng
EUR 603
ATG10 Protein Vector (Rat) (pPB-N-His)
PV255071 500 ng
EUR 603
ATG10 Protein Vector (Rat) (pPM-C-HA)
PV255072 500 ng
EUR 603
ATG10 Protein Vector (Rat) (pPM-C-His)
PV255073 500 ng
EUR 603
ATG10 Protein Vector (Human) (pPB-His-MBP)
PV324714 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-His-GST)
PV324715 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-His-MBP)
PV324718 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-His-GST)
PV324719 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-C-His)
PV002917 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-N-His)
PV002918 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPM-C-HA)
PV002919 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPM-C-His)
PV002920 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-C-His)
PV002921 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPB-N-His)
PV002922 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPM-C-HA)
PV002923 500 ng
EUR 329
ATG10 Protein Vector (Human) (pPM-C-His)
PV002924 500 ng
EUR 329
Atg10 3'UTR GFP Stable Cell Line
TU152261 1.0 ml Ask for price
Atg10 3'UTR Luciferase Stable Cell Line
TU102261 1.0 ml Ask for price
Atg10 3'UTR Luciferase Stable Cell Line
TU201021 1.0 ml Ask for price
Atg10 3'UTR GFP Stable Cell Line
TU251021 1.0 ml Ask for price
ATG10 3'UTR GFP Stable Cell Line
TU051346 1.0 ml
EUR 1521
ATG10 3'UTR Luciferase Stable Cell Line
TU001346 1.0 ml
EUR 1521
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

ATG10 Rabbit Polyclonal Antibody