IRF5 Rabbit Polyclonal Antibody

IRF5 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

IRF5 Polyclonal Antibody

ABP58963-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460

IRF5 Polyclonal Antibody

ABP58963-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460

IRF5 Polyclonal Antibody

ES8994-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IRF5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IRF5 Polyclonal Antibody

ES8994-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IRF5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IRF5 Rabbit mAb

A11106-100ul 100 ul
EUR 410

IRF5 Rabbit mAb

A11106-200ul 200 ul
EUR 571

IRF5 Rabbit mAb

A11106-20ul 20 ul
EUR 221

IRF5 Rabbit mAb

A11106-50ul 50 ul
EUR 287

IRF5 Rabbit pAb

A1149-100ul 100 ul
EUR 308

IRF5 Rabbit pAb

A1149-200ul 200 ul
EUR 459

IRF5 Rabbit pAb

A1149-20ul 20 ul
EUR 183

IRF5 Rabbit pAb

A1149-50ul 50 ul
EUR 223

IRF5 Rabbit pAb

A13621-100ul 100 ul
EUR 308

IRF5 Rabbit pAb

A13621-200ul 200 ul
EUR 459

IRF5 Rabbit pAb

A13621-20ul 20 ul
EUR 183

IRF5 Rabbit pAb

A13621-50ul 50 ul
EUR 223

IRF5 Rabbit pAb

A16388-100ul 100 ul
EUR 308

IRF5 Rabbit pAb

A16388-200ul 200 ul
EUR 459

IRF5 Rabbit pAb

A16388-20ul 20 ul
EUR 183

IRF5 Rabbit pAb

A16388-50ul 50 ul
EUR 223

Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit

DLR-IRF5-Hu-48T 48T
EUR 444
  • Should the Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit

DLR-IRF5-Hu-96T 96T
EUR 573
  • Should the Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit

DLR-IRF5-Mu-48T 48T
EUR 454
  • Should the Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit

DLR-IRF5-Mu-96T 96T
EUR 587
  • Should the Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RDR-IRF5-Hu-48Tests 48 Tests
EUR 458

Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RDR-IRF5-Hu-96Tests 96 Tests
EUR 633

Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RDR-IRF5-Mu-48Tests 48 Tests
EUR 470

Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RDR-IRF5-Mu-96Tests 96 Tests
EUR 651

Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RD-IRF5-Hu-48Tests 48 Tests
EUR 439

Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RD-IRF5-Hu-96Tests 96 Tests
EUR 606

Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RD-IRF5-Mu-48Tests 48 Tests
EUR 450

Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit

RD-IRF5-Mu-96Tests 96 Tests
EUR 622

Anti-IRF5 Rabbit Monoclonal Antibody

M00958 100ug/vial
EUR 397
Description: Rabbit Monoclonal IRF5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-IRF5 Rabbit Monoclonal Antibody

M00958-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal IRF5 Antibody. Validated in WB and tested in Human.

Polyclonal Goat Anti-IRF5 Antibody

APG00173G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IRF5 . This antibody is tested and proven to work in the following applications:

Irf5 Polyclonal Antibody, HRP Conjugated

A62795 100 µg
EUR 570.55
Description: reagents widely cited

Irf5 Polyclonal Antibody, FITC Conjugated

A62796 100 µg
EUR 570.55
Description: Ask the seller for details

Irf5 Polyclonal Antibody, Biotin Conjugated

A62797 100 µg
EUR 570.55
Description: The best epigenetics products

IRF5 antibody

70R-18009 50 ul
EUR 435
Description: Rabbit polyclonal IRF5 antibody

IRF5 Antibody

32184-100ul 100ul
EUR 252

IRF5 antibody

10R-1026 100 ul
EUR 316
Description: Mouse monoclonal IRF5 antibody

IRF5 Antibody

49111-100ul 100ul
EUR 333

IRF5 Antibody

49111-50ul 50ul
EUR 239

IRF5 Antibody

49123-100ul 100ul
EUR 333

IRF5 Antibody

49123-50ul 50ul
EUR 239

IRF5 Antibody

DF6283 200ul
EUR 304
Description: IRF5 Antibody detects endogenous levels of total IRF5.

IRF5 Antibody

1-CSB-PA011820GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

IRF5 Antibody

1-CSB-PA011820LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Irf5 Antibody

1-CSB-PA011820LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

IRF5 Antibody

ABD6283 100 ug
EUR 438

Polyclonal IRF5 antibody - N-terminal region

APR00727G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF5 - N-terminal region. This antibody is tested and proven to work in the following applications:

IRF5 (Phospho-Ser437) Polyclonal Conjugated Antibody

C12688 100ul
EUR 397

IRF5 (pS437) Antibody

abx216307-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

IRF5 Conjugated Antibody

C49111 100ul
EUR 397

IRF5 Conjugated Antibody

C32184 100ul
EUR 397

anti- IRF5 antibody

FNab04391 100µg
EUR 505.25
  • Immunogen: interferon regulatory factor 5
  • Uniprot ID: Q13568
  • Gene ID: 3663
  • Research Area: Epigenetics, Cancer, Immunology, Metabolism
Description: Antibody raised against IRF5

anti- IRF5 antibody

FNab04392 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:3000
  • Immunogen: interferon regulatory factor 5
  • Uniprot ID: Q13568
  • Gene ID: 3663
  • Research Area: Epigenetics, Cancer, Immunology, Metabolism
Description: Antibody raised against IRF5

Anti-IRF5 Antibody

PA2208 100ug/vial
EUR 294

Anti-IRF5 antibody

PAab04391 100 ug
EUR 355

Anti-IRF5 Antibody

PB9646 100ug/vial
EUR 334

Anti-IRF5 antibody

STJ24230 100 µl
EUR 277
Description: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment.

Anti-IRF5 antibody

STJ115580 100 µl
EUR 277
Description: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment.

Anti-IRF5 antibody

STJ118828 100 µl
EUR 277

Anti-IRF5 antibody

STJ190152 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IRF5

Anti-IRF5 antibody

STJ70233 100 µg
EUR 359

IRF5 siRNA

20-abx920802
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IRF5 siRNA

20-abx920803
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IRF5

YF-PA12773 50 ul
EUR 363
Description: Mouse polyclonal to IRF5

anti-IRF5

YF-PA12774 100 ug
EUR 403
Description: Rabbit polyclonal to IRF5

Rabbit Anti-IRF5 monoclonal antibody, clone TE314-18

CABT-L772 100 ul
EUR 777

IRF5 (Phospho-Ser437) Antibody

12688-100ul 100ul
EUR 252

IRF5 (Phospho-Ser437) Antibody

12688-50ul 50ul
EUR 187

IRF5 Antibody, HRP conjugated

1-CSB-PA011820LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Irf5 Antibody, HRP conjugated

1-CSB-PA011820LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

IRF5 Antibody, FITC conjugated

1-CSB-PA011820LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Irf5 Antibody, FITC conjugated

1-CSB-PA011820LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

IRF5 Antibody, Biotin conjugated

1-CSB-PA011820LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Irf5 Antibody, Biotin conjugated

1-CSB-PA011820LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-IRF5 (Ser437) Antibody

AF8382 200ul
EUR 376
Description: IRF5 (Phospho-Ser437) Antibody detects endogenous levels of IRF5 only when phosphorylated at Ser437.

IRF5 (Phospho- Ser437) Antibody

ABF8382 100 ug
EUR 438

IRF5 recombinant monoclonal antibody

A5366 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human IRF5 for WB, IHC,ELISA

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human)

4-PAB598Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5)

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse)

4-PAB598Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5)

Rabbit Anti-Human IRF5 monoclonal antibody, clone TO312-06

CABT-L766 100 ul
EUR 777

IRF5 Blocking Peptide

DF6283-BP 1mg
EUR 195

IRF5 Blocking Peptide

20-abx161140
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IRF5 cloning plasmid

CSB-CL011820HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1497
  • Sequence: atgaaccagtccatcccagtggctcccaccccaccccgccgcgtgcggctgaagccctggctggtggcccaggtgaacagctgccagtacccagggcttcaatgggtcaacggggaaaagaaattattctgcatcccctggaggcatgccacaaggcatggtcccagccaggacg
  • Show more
Description: A cloning plasmid for the IRF5 gene.

Anti-IRF5 (2D4)

YF-MA10491 100 ug
EUR 363
Description: Mouse monoclonal to IRF5

Anti-IRF5 (1H6)

YF-MA13857 100 ug
EUR 363
Description: Mouse monoclonal to IRF5

Anti-IRF5 (3C2)

YF-MA13858 100 ug
EUR 363
Description: Mouse monoclonal to IRF5

Anti-IRF5 (2G9)

YF-MA13859 100 ug
EUR 363
Description: Mouse monoclonal to IRF5

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), APC

4-PAB598Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with APC.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), Biotinylated

4-PAB598Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with Biotin.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), Cy3

4-PAB598Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with Cy3.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), FITC

4-PAB598Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with FITC.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), HRP

4-PAB598Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with HRP.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), PE

4-PAB598Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with PE.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), APC

4-PAB598Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with APC.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), Biotinylated

4-PAB598Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with Biotin.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), Cy3

4-PAB598Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with Cy3.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), FITC

4-PAB598Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with FITC.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), HRP

4-PAB598Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with HRP.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), PE

4-PAB598Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with PE.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human), APC-Cy7

4-PAB598Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with APC-Cy7.

Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB598Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5). This antibody is labeled with APC-Cy7.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx177049
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx113216
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx121140
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx128146
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx129681
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx173018
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interferon Regulatory Factor 5 (IRF5) Antibody

abx031731-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

abx031731-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mouse Anti Human Irf5 Monoclonal Antibody

CABT-52299MH 0.1 mg
EUR 767

Interferon Regulatory Factor 5 (Irf5) Antibody

20-abx319052
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

abx234391-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

abx234392-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

abx432874-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx302567
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody

20-abx001063
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

IRF5 protein (His tag)

80R-3750 20 ug
EUR 349
Description: Purified recombinant IRF5 protein (His tag)

IRF5 ELISA KIT|Human

EF006944 96 Tests
EUR 689

Mouse IRF5 shRNA Plasmid

20-abx973827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IRF5 shRNA Plasmid

20-abx952456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IRF5 Recombinant Protein (Human)

RP016318 100 ug Ask for price

IRF5 Recombinant Protein (Rat)

RP206237 100 ug Ask for price

IRF5 Recombinant Protein (Mouse)

RP144203 100 ug Ask for price

IRF5 Recombinant Protein (Mouse)

RP144206 100 ug Ask for price

Interferon Regulatory Factor 5 (Irf5) Antibody (HRP)

20-abx319053
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (Irf5) Antibody (FITC)

20-abx319054
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (Irf5) Antibody (Biotin)

20-abx319055
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody (HRP)

20-abx312839
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody (FITC)

20-abx312840
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Regulatory Factor 5 (IRF5) Antibody (Biotin)

20-abx312841
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal IRF5 Antibody (monoclonal) (M03), Clone: 1H6

AMM03687G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human IRF5 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1H6. This antibody is applicable in WB and IF, IP, E

Monoclonal IRF5 Antibody (monoclonal) (M05), Clone: 2D4

AMM03688G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human IRF5 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 2D4. This antibody is applicable in WB, IHC and IF

Phospho-IRF5 (Ser437) Blocking Peptide

AF8382-BP 1mg
EUR 195

Irf5 ORF Vector (Rat) (pORF)

ORF068747 1.0 ug DNA
EUR 506

IRF5 ORF Vector (Human) (pORF)

ORF005440 1.0 ug DNA
EUR 95

Irf5 ORF Vector (Mouse) (pORF)

ORF048069 1.0 ug DNA
EUR 506

Irf5 ORF Vector (Mouse) (pORF)

ORF048070 1.0 ug DNA
EUR 506

pECMV-Irf5-m-FLAG Plasmid

PVT15688 2 ug
EUR 325

IRF5 ELISA Kit (Human) (OKCA02112)

OKCA02112 96 Wells
EUR 833
Description: Description of target: Transcription factor involved in the induction of interferons IFNA and INFB and inflammatory cytokines upon virus infection. Activated by TLR7 or TLR8 signaling.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

IRF5 ELISA Kit (Mouse) (OKCD07515)

OKCD07515 96 Wells
EUR 818
Description: Description of target: The activation of Toll-like receptors (TLRs) is central to innate and adaptive immunity. All TLRs use the adaptor MyD88 for signaling. IRF-5 is generally involved downstream of the TLR-MyD88 signalling pathway for gene induction of proinflammatory cytokines, such as interleukin-6 (IL-6), IL-12 and tumour-necrosis factor-alpha.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.048ng/mL

IRF5 ELISA Kit (Mouse) (OKEH03396)

OKEH03396 96 Wells
EUR 662
Description: Description of target: Transcription factor involved in the induction of interferons IFNA and INFB and inflammatory cytokines upon virus infection. Activated by TLR7 or TLR8 signaling.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 42.6 pg/mL

Mouse Interferon regulatory factor 5 (Irf5)

1-CSB-EP011820MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 72 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Interferon regulatory factor 5(Irf5) expressed in E.coli

Irf5 sgRNA CRISPR Lentivector set (Rat)

K6023801 3 x 1.0 ug
EUR 339

Irf5 sgRNA CRISPR Lentivector set (Mouse)

K3709201 3 x 1.0 ug
EUR 339

IRF5 sgRNA CRISPR Lentivector set (Human)

K1098701 3 x 1.0 ug
EUR 339

Recombinant Interferon Regulatory Factor 5 (IRF5)

4-RPB598Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13568
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Interferon Regulatory Factor 5 expressed in: E.coli

Recombinant Interferon Regulatory Factor 5 (IRF5)

4-RPB598Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P56477
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.3kDa
  • Isoelectric Point: 5.5
Description: Recombinant Mouse Interferon Regulatory Factor 5 expressed in: E.coli

Human Interferon Regulatory Factor 5 (IRF5) Protein

20-abx166944
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Interferon Regulatory Factor 5 (IRF5) Protein

20-abx167492
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Interferon Regulatory Factor 5 (IRF5) Protein

20-abx263252
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Irf5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6023802 1.0 ug DNA
EUR 154

Irf5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6023803 1.0 ug DNA
EUR 154

Irf5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6023804 1.0 ug DNA
EUR 154

Irf5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3709202 1.0 ug DNA
EUR 154

Irf5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3709203 1.0 ug DNA
EUR 154

Irf5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3709204 1.0 ug DNA
EUR 154

IRF5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1098702 1.0 ug DNA
EUR 154

IRF5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1098703 1.0 ug DNA
EUR 154

IRF5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1098704 1.0 ug DNA
EUR 154

IRF5 Protein Vector (Human) (pPB-C-His)

PV021757 500 ng
EUR 329

IRF5 Protein Vector (Human) (pPB-N-His)

PV021758 500 ng
EUR 329

IRF5 Protein Vector (Human) (pPM-C-HA)

PV021759 500 ng
EUR 329

IRF5 Protein Vector (Human) (pPM-C-His)

PV021760 500 ng
EUR 329

IRF5 Protein Vector (Rat) (pPB-C-His)

PV274986 500 ng
EUR 603

IRF5 Protein Vector (Rat) (pPB-N-His)

PV274987 500 ng
EUR 603

IRF5 Protein Vector (Rat) (pPM-C-HA)

PV274988 500 ng
EUR 603

IRF5 Protein Vector (Rat) (pPM-C-His)

PV274989 500 ng
EUR 603

IRF5 Protein Vector (Mouse) (pPB-C-His)

PV192274 500 ng
EUR 1065

IRF5 Protein Vector (Mouse) (pPB-N-His)

PV192275 500 ng
EUR 1065

IRF5 Protein Vector (Mouse) (pPM-C-HA)

PV192276 500 ng
EUR 1065

IRF5 Protein Vector (Mouse) (pPM-C-His)

PV192277 500 ng
EUR 1065

IRF5 Protein Vector (Mouse) (pPB-C-His)

PV192278 500 ng
EUR 603

IRF5 Protein Vector (Mouse) (pPB-N-His)

PV192279 500 ng
EUR 603

IRF5 Protein Vector (Mouse) (pPM-C-HA)

PV192280 500 ng
EUR 603

IRF5 Protein Vector (Mouse) (pPM-C-His)

PV192281 500 ng
EUR 603

Irf5 3'UTR Luciferase Stable Cell Line

TU110215 1.0 ml Ask for price

Irf5 3'UTR GFP Stable Cell Line

TU160215 1.0 ml Ask for price

Irf5 3'UTR Luciferase Stable Cell Line

TU206374 1.0 ml Ask for price

Irf5 3'UTR GFP Stable Cell Line

TU256374 1.0 ml Ask for price

IRF5 3'UTR GFP Stable Cell Line

TU061262 1.0 ml
EUR 1521

IRF5 3'UTR Luciferase Stable Cell Line

TU011262 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

IRF5 Rabbit Polyclonal Antibody