EPHB1 Rabbit Polyclonal Antibody

EPHB1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

EPHB1 Polyclonal Antibody
ES8966-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EPHB1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPHB1 Polyclonal Antibody
ES8966-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EPHB1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPHB1 Polyclonal Antibody
ABP58489-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EPHB1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of EPHB1 from Human, Mouse. This EPHB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPHB1 protein at amino acid sequence of 720-800

EPHB1 Polyclonal Antibody
ABP58489-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EPHB1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of EPHB1 from Human, Mouse. This EPHB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPHB1 protein at amino acid sequence of 720-800

EPHB1 Polyclonal Antibody
ABP58489-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EPHB1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of EPHB1 from Human, Mouse. This EPHB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPHB1 protein at amino acid sequence of 720-800

EphB1 Polyclonal Antibody
ABP54133-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EphB1 at AA rangle: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1 from Human, Mouse, Rat, Monkey. This EphB1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EphB1 at AA rangle: 810-890

EphB1 Polyclonal Antibody
ABP54133-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EphB1 at AA rangle: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1 from Human, Mouse, Rat, Monkey. This EphB1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EphB1 at AA rangle: 810-890

EphB1 Polyclonal Antibody
ABP54133-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EphB1 at AA rangle: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1 from Human, Mouse, Rat, Monkey. This EphB1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EphB1 at AA rangle: 810-890

EPHB1 Rabbit pAb
A8415-100ul 100 ul
EUR 308

EPHB1 Rabbit pAb
A8415-200ul 200 ul
EUR 459

EPHB1 Rabbit pAb
A8415-20ul 20 ul
EUR 183

EPHB1 Rabbit pAb
A8415-50ul 50 ul
EUR 223

Polyclonal EphB1 (extracellular) Antibody
APR11873G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EphB1 (extracellular) . This antibody is tested and proven to work in the following applications:

EphB1/2 Polyclonal Antibody
ES2273-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EphB1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

EphB1/2 Polyclonal Antibody
ES2273-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EphB1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

EphB1/2 Polyclonal Antibody
ABP51274-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human EphB1/2 around the non-phosphorylation site of Y594/604
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2 from Human, Mouse, Rat. This EphB1/2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2 around the non-phosphorylation site of Y594/604

EphB1/2 Polyclonal Antibody
ABP51274-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human EphB1/2 around the non-phosphorylation site of Y594/604
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2 from Human, Mouse, Rat. This EphB1/2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2 around the non-phosphorylation site of Y594/604

EphB1/2 Polyclonal Antibody
ABP51274-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human EphB1/2 around the non-phosphorylation site of Y594/604
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2 from Human, Mouse, Rat. This EphB1/2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2 around the non-phosphorylation site of Y594/604

EphB1/2 Polyclonal Antibody
40889-100ul 100ul
EUR 252

EphB1/2 Polyclonal Antibody
40889-50ul 50ul
EUR 187

Polyclonal Mouse Ephb1 Antibody (Center)
AMM06434G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Ephb1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Ephb1 Antibody (Center)
AMM06435G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Ephb1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Ephb1 Antibody (Center)
AMM06436G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Ephb1 (Center). This antibody is tested and proven to work in the following applications:

EphB1/2 Polyclonal Conjugated Antibody
C40889 100ul
EUR 397

Polyclonal EphB1 Antibody (C-term)
APR05954G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EphB1 (C-term). This antibody is tested and proven to work in the following applications:

EphB1/2/3 Polyclonal Antibody
ES5133-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EphB1/2/3 from Human/Mouse. This antibody is tested and validated for IHC, IF, WB, ELISA

EphB1/2/3 Polyclonal Antibody
ES5133-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EphB1/2/3 from Human/Mouse. This antibody is tested and validated for IHC, IF, WB, ELISA

EphB1/2/3 Polyclonal Antibody
ABP54134-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human EphB1/2/3 at AA rangle: 600-680
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2/3 from Human, Mouse. This EphB1/2/3 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EphB1/2/3 at AA rangle: 600-680

EphB1/2/3 Polyclonal Antibody
ABP54134-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human EphB1/2/3 at AA rangle: 600-680
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2/3 from Human, Mouse. This EphB1/2/3 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EphB1/2/3 at AA rangle: 600-680

EphB1/2/3 Polyclonal Antibody
ABP54134-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human EphB1/2/3 at AA rangle: 600-680
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2/3 from Human, Mouse. This EphB1/2/3 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EphB1/2/3 at AA rangle: 600-680

EPHB1 Antibody
AF5236 200ul
EUR 304
Description: EPHB1 Antibody detects endogenous levels of total EPHB1.

EPHB1 Antibody
ABF5236 100 ug
EUR 438

EPHB1 Antibody
ABD4780 100 ug
EUR 438

EPHB1 Antibody
35286-100ul 100ul
EUR 252

EPHB1 Antibody
35286-50ul 50ul
EUR 187

EPHB1 Antibody
43459-100ul 100ul
EUR 252

EphB1 antibody
10R-2126 100 ul
EUR 435
Description: Mouse monoclonal EphB1 antibody

EPHB1 Antibody
DF4780 200ul
EUR 304
Description: EPHB1 Antibody detects endogenous levels of total EPHB1.

EPHB1 Antibody
1-CSB-PA007729ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EPHB1. Recognizes EPHB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EPHB1 Antibody
1-CSB-PA008066
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EPHB1. Recognizes EPHB1 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EPHB1 Antibody
CSB-PA073597-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EPHB1. Recognizes EPHB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EPHB1 Antibody
CSB-PA073597-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EPHB1. Recognizes EPHB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EPHB1 (Phospho-Tyr928) Polyclonal Conjugated Antibody
C12717 100ul
EUR 397

EphB1/2/3/4 Polyclonal Antibody
ES5134-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EphB1/2/3/4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EphB1/2/3/4 Polyclonal Antibody
ES5134-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EphB1/2/3/4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EphB1/2/3/4 Polyclonal Antibody
ABP54135-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human EphB1/2/3/4 around the non-phosphorylation site of Y600/602/614/596
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2/3/4 from Human, Mouse. This EphB1/2/3/4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2/3/4 around the non-phosphorylation site of Y600/602/614/596

EphB1/2/3/4 Polyclonal Antibody
ABP54135-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human EphB1/2/3/4 around the non-phosphorylation site of Y600/602/614/596
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2/3/4 from Human, Mouse. This EphB1/2/3/4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2/3/4 around the non-phosphorylation site of Y600/602/614/596

EphB1/2/3/4 Polyclonal Antibody
ABP54135-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human EphB1/2/3/4 around the non-phosphorylation site of Y600/602/614/596
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2/3/4 from Human, Mouse. This EphB1/2/3/4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2/3/4 around the non-phosphorylation site of Y600/602/614/596

EPHB1 Conjugated Antibody
C43459 100ul
EUR 397

EPHB1 / 2 Antibody
20-abx141026
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EPHB1 / EPHB2 Antibody
20-abx329487
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPHB1 (pY928) Antibody
abx215189-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

EPHB1/2 antibody
70R-51798 100 ul
EUR 287
Description: Purified Polyclonal EPHB1/2 antibody

EPHB1/2 antibody
70R-33573 100 ug
EUR 327
Description: Rabbit polyclonal EPHB1/2 antibody

EPHB1/EPHB2 Antibody
1-CSB-PA002364
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EPHB1/EPHB2. Recognizes EPHB1/EPHB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Anti-EphB1 antibody
STJ92947 200 µl
EUR 197
Description: Rabbit polyclonal to EphB1.

Anti-EphB1 antibody
STJ98031 100 µl
EUR 234
Description: Mouse monoclonal to EphB1.

Anti-EPHB1 antibody
STJ110713 100 µl
EUR 277
Description: Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members.

Anti-EPHB1 antibody
STJ190124 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EPHB1

Ephb1/ Rat Ephb1 ELISA Kit
ELI-26065r 96 Tests
EUR 886

EphB1/2 (phospho Tyr594/604) Polyclonal Antibody
ES1449-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EphB1/2 (phospho Tyr594/604) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

EphB1/2 (phospho Tyr594/604) Polyclonal Antibody
ES1449-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EphB1/2 (phospho Tyr594/604) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

EphB1/2 (phospho Tyr594/604) Polyclonal Antibody
ABP50450-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human EphB1/2 around the phosphorylation site of Y594/604
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2 phospho Tyr594/604) from Human, Mouse, Rat. This EphB1/2 phospho Tyr594/604) antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2 around the phosphorylation site of Y594/604

EphB1/2 (phospho Tyr594/604) Polyclonal Antibody
ABP50450-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human EphB1/2 around the phosphorylation site of Y594/604
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2 phospho Tyr594/604) from Human, Mouse, Rat. This EphB1/2 phospho Tyr594/604) antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2 around the phosphorylation site of Y594/604

EphB1/2 (phospho Tyr594/604) Polyclonal Antibody
ABP50450-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human EphB1/2 around the phosphorylation site of Y594/604
  • Applications tips:
Description: A polyclonal antibody for detection of EphB1/2 phospho Tyr594/604) from Human, Mouse, Rat. This EphB1/2 phospho Tyr594/604) antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EphB1/2 around the phosphorylation site of Y594/604

EphB1/2 (Phospho-Tyr594/604) Polyclonal Antibody
12273-100ul 100ul
EUR 252

EphB1/2 (Phospho-Tyr594/604) Polyclonal Antibody
12273-50ul 50ul
EUR 187

EPHB1 siRNA
20-abx901748
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EPHB1 siRNA
20-abx915518
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EPHB1 siRNA
20-abx915519
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EphB1/2 (Phospho-Tyr594/604) Polyclonal Polyclonal Conjugated Antibody
C12273 100ul
EUR 397

Phospho-EPHB1 (Tyr928) Antibody
AF8429 200ul
EUR 376
Description: EPHB1 (Phospho-Tyr928) Antibody detects endogenous levels of EPHB1 only when phosphorylated at Tyr928.

EPHB1 / 2 / 3 Antibody
20-abx014461
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

EPHB1 (Phospho- Tyr928) Antibody
ABF8429 100 ug
EUR 438

EPHB1 / EPHB2 / EPHB3 Antibody
20-abx325320
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPHB1 / EPHB2 / EPHB3 Antibody
abx331319-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

EPHB1/2/3 antibody
70R-35821 100 ug
EUR 327
Description: Rabbit polyclonal EPHB1/2/3 antibody

EPHB1/2/3 Antibody
34676-100ul 100ul
EUR 252

EPHB1/2/3 Antibody
34676-50ul 50ul
EUR 187

EPHB1 (Phospho-Tyr928) Antibody
12717-100ul 100ul
EUR 252

EPHB1 (Phospho-Tyr928) Antibody
12717-50ul 50ul
EUR 187

EPHB1/EPHB2/EPHB3 Antibody
1-CSB-PA008068
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EPHB1/EPHB2/EPHB3. Recognizes EPHB1/EPHB2/EPHB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

EPHB1/EPHB2/EPHB3 Antibody
CSB-PA106334-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EPHB1/EPHB2/EPHB3. Recognizes EPHB1/EPHB2/EPHB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

EPHB1/EPHB2/EPHB3 Antibody
CSB-PA106334-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EPHB1/EPHB2/EPHB3. Recognizes EPHB1/EPHB2/EPHB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

Anti-EphB1/2 antibody
STJ92948 200 µl
EUR 197
Description: Rabbit polyclonal to EphB1/2.

EPHB1/2 (Phospho-Tyr778/Tyr780) Polyclonal Conjugated Antibody
C12718 100ul
EUR 397

Anti-Phospho-EphB1/2 (Tyr594/604) Polyclonal Antibody
P02811 100ul
EUR 397
Description: Rabbit Polyclonal Phospho-EphB1/2 (Tyr594/604) Polyclonal Antibody. Validated in WB and tested in Human, Mouse, Rat.

EPHB1 Blocking Peptide
AF5236-BP 1mg
EUR 195

EPHB1 cloning plasmid
CSB-CL007729HU-10ug 10ug
EUR 937
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2955
  • Sequence: ATGGCCCTGGATTATCTACTACTGCTCCTCCTGGCATCCGCAGTGGCTGCGATGGAAGAAACGTTAATGGACACCAGAACGGCTACTGCAGAGCTGGGCTGGACGGCCAATCCTGCGTCCGGGTGGGAAGAAGTCAGTGGCTACGATGAAAACCTGAACACCATCCGCACCTACC
  • Show more
Description: A cloning plasmid for the EPHB1 gene.

EPHB1 Blocking Peptide
20-abx162110
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EPHB1 Blocking Peptide
DF4780-BP 1mg
EUR 195

EPHB1/2/3 Conjugated Antibody
C34676 100ul
EUR 397

EPHB1 / 2 (pY594 / 604) Antibody
20-abx134101
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EPHB1 / 2 / 3 / 4 Antibody
20-abx012913
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

EPHB1 / EPHB2 / EPHB3 / EPHB4 Antibody
20-abx325738
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPHB1 / EPHB2 (pY594 / 604) Antibody
20-abx328150
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPHB1 / 2 (pY778 / Y780) Antibody
abx215190-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

EPH Receptor B1 (EPHB1) Antibody
20-abx329864
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EPH Receptor B1 (EPHB1) Antibody
abx330728-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

EPHB1/2 antibody (Tyr594/604)
70R-33572 100 ug
EUR 327
Description: Rabbit polyclonal EPHB1/2 antibody (Tyr594/604)

EPHB1/EPHB2/EPHB3/EPHB4 Antibody
1-CSB-PA008069
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EPHB1/EPHB2/EPHB3/EPHB4. Recognizes EPHB1/EPHB2/EPHB3/EPHB4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Anti-EphB1/2/3 antibody
STJ92949 200 µl
EUR 197
Description: Rabbit polyclonal to EphB1/2/3.

Phospho-EPHB1/2 (Tyr778/Tyr780) Antibody
AF8430 200ul
EUR 376
Description: EPHB1/2 (Phospho-Tyr778/Tyr780) Antibody detects endogenous levels of EPHB1/2 only when phosphorylated at Tyr778/Tyr780.

EPHB1/2 (Phospho- Tyr778/Tyr780) Antibody
ABF8430 100 ug
EUR 438

EPHB1/2 (Phospho-Tyr778/Tyr780) Antibody
12718-100ul 100ul
EUR 252

EPHB1/2 (Phospho-Tyr778/Tyr780) Antibody
12718-50ul 50ul
EUR 187

Phospho-EPHB1/EPHB2 (Y594/604) Antibody
1-CSB-PA000666
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EPHB1/EPHB2 (Y594/604). Recognizes Phospho-EPHB1/EPHB2 (Y594/604) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/5000

Anti-Eph receptor B1/EPHB1 Antibody
PB9584 100ug/vial
EUR 334

Anti-EphB1/2/3/4 antibody
STJ92950 200 µl
EUR 197
Description: Rabbit polyclonal to EphB1/2/3/4.

Mouse EPHB1 shRNA Plasmid
20-abx983105
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EPHB1 shRNA Plasmid
20-abx984447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPHB1 / 2 Blocking Peptide
20-abx061724
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human EPHB1 shRNA Plasmid
20-abx951424
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pDsRed1-N1-Ephb1 Plasmid
PVTB50062-2a 2 ug
EUR 356

Ephrin Type-B Receptor 1 (EPHB1) Antibody
abx145212-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EPHB1) Antibody
20-abx133401
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EphB1) Antibody
abx033530-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EphB1) Antibody
abx033530-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EphB1) Antibody
abx033531-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EphB1) Antibody
abx033531-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EPHB1) Antibody
20-abx005830
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EPHB1) Antibody
20-abx015160
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ephrin Type-B Receptor 1 (EPHB1) Antibody
20-abx321296
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Phospho-EphB1/2 (Y594/604) antibody
STJ90711 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-EphB1/2 (Y594/604).

Phospho-EPHB1 (Tyr928) Blocking Peptide
AF8429-BP 1mg
EUR 195

EPHB1 / 2 Cell ELISA Kit
abx595203-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Ephb1 ORF Vector (Rat) (pORF)
ORF066589 1.0 ug DNA
EUR 506

Ephb1 ORF Vector (Mouse) (pORF)
ORF043992 1.0 ug DNA
EUR 506

Ephb1 ORF Vector (Mouse) (pORF)
ORF043993 1.0 ug DNA
EUR 506

EPHB1 ORF Vector (Human) (pORF)
ORF018931 1.0 ug DNA
EUR 405

pECMV-Ephb1-m-FLAG Plasmid
PVT15089 2 ug
EUR 325

EPHB1 ELISA Kit (Human) (OKCA01224)
OKCA01224 96 Wells
EUR 846
Description: Description of target: Receptor tyrosine kinase which binds promiscuously transmembrane ephrin-B family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Cognate/functional ephrin ligands for this receptor include EFNB1, EFNB2 and EFNB3. During nervous system development, regulates retinal axon guidance redirecting ipsilaterally ventrotemporal retinal ganglion cells axons at the optic chiasm midline. This probably requires repulsive interaction with EFNB2. In the adult nervous system together with EFNB3, regulates chemotaxis, proliferation and polarity of the hippocampus neural progenitors. In addition to its role in axon guidance plays also an important redundant role with other ephrin-B receptors in development and maturation of dendritic spines and synapse formation. May also regulate angiogenesis. More generally, may play a role in targeted cell migration and adhesion. Upon activation by EFNB1 and probably other ephrin-B ligands activates the MAPK/ERK and the JNK signaling cascades to regulate cell migration and adhesion respectively.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

EPHB1/2/3/4 (Phospho-Tyr600/602/614/596) Polyclonal Conjugated Antibody
C12501 100ul
EUR 397

EPHB1 / 2 (pY594 / 604) Blocking Peptide
20-abx162341
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EPHB1 sgRNA CRISPR Lentivector set (Human)
K0687101 3 x 1.0 ug
EUR 339

Ephb1 sgRNA CRISPR Lentivector set (Mouse)
K3795601 3 x 1.0 ug
EUR 339

Ephb1 sgRNA CRISPR Lentivector set (Rat)
K6894201 3 x 1.0 ug
EUR 339

EPHB1 / 2 / 3 / 4 (pY600 / 602 / 614 / 596) Antibody
abx215187-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Phospho-EPHB1/2 (Tyr778/Tyr780) Blocking Peptide
AF8430-BP 1mg
EUR 195

EPHB1 / 2 / 3 / 4 Cell ELISA Kit
abx595204-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

EPHB1/2 Colorimetric Cell-Based ELISA Kit
EKC1193 100ul
EUR 572

EPHB1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0687102 1.0 ug DNA
EUR 154

EPHB1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0687103 1.0 ug DNA
EUR 154

EPHB1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0687104 1.0 ug DNA
EUR 154

Ephb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3795602 1.0 ug DNA
EUR 154

Ephb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3795603 1.0 ug DNA
EUR 154

Ephb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3795604 1.0 ug DNA
EUR 154

Ephb1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6894202 1.0 ug DNA
EUR 154

Ephb1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6894203 1.0 ug DNA
EUR 154

Ephb1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6894204 1.0 ug DNA
EUR 154

EphB1 Protein Vector (Human) (pPB-C-His)
PV075721 500 ng
EUR 811

EphB1 Protein Vector (Human) (pPB-N-His)
PV075722 500 ng
EUR 811

EphB1 Protein Vector (Human) (pPM-C-HA)
PV075723 500 ng
EUR 811

EphB1 Protein Vector (Human) (pPM-C-His)
PV075724 500 ng
EUR 811

EphB1 Protein Vector (Mouse) (pPB-C-His)
PV175966 500 ng
EUR 1065

EphB1 Protein Vector (Mouse) (pPB-N-His)
PV175967 500 ng
EUR 1065

EphB1 Protein Vector (Mouse) (pPM-C-HA)
PV175968 500 ng
EUR 1065

EphB1 Protein Vector (Mouse) (pPM-C-His)
PV175969 500 ng
EUR 1065

EphB1 Protein Vector (Mouse) (pPB-C-His)
PV175970 500 ng
EUR 1065

EphB1 Protein Vector (Mouse) (pPB-N-His)
PV175971 500 ng
EUR 1065

EphB1 Protein Vector (Mouse) (pPM-C-HA)
PV175972 500 ng
EUR 1065

EPHB1 Rabbit Polyclonal Antibody

 

Apex Business WordPress Theme | Designed by Crafthemes