HDGF Rabbit Polyclonal Antibody

HDGF Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

HDGF Polyclonal Antibody
ES8731-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA
HDGF Polyclonal Antibody
ES8731-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA
HDGF Polyclonal Antibody
ABP58763-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
HDGF Polyclonal Antibody
ABP58763-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
HDGF Polyclonal Antibody
ABP58763-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
HDGF Polyclonal Antibody
A53048 100 µg
EUR 570.55
Description: Ask the seller for details
HDGF Polyclonal Antibody
46852-100ul 100ul
EUR 252
HDGF Polyclonal Antibody
46852-50ul 50ul
EUR 187
HDGF Rabbit pAb
A5347-100ul 100 ul
EUR 308
HDGF Rabbit pAb
A5347-200ul 200 ul
EUR 459
HDGF Rabbit pAb
A5347-20ul 20 ul
EUR 183
HDGF Rabbit pAb
A5347-50ul 50 ul
EUR 223
HDGF Rabbit pAb
A13654-100ul 100 ul
EUR 308
HDGF Rabbit pAb
A13654-200ul 200 ul
EUR 459
HDGF Rabbit pAb
A13654-20ul 20 ul
EUR 183
HDGF Rabbit pAb
A13654-50ul 50 ul
EUR 223
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Hu-48T 48T
EUR 425
  • Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Hu-96T 96T
EUR 548
  • Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Mu-48T 48T
EUR 435
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Mu-96T 96T
EUR 561
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Hu-48Tests 48 Tests
EUR 418
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Hu-96Tests 96 Tests
EUR 575
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Mu-48Tests 48 Tests
EUR 429
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Mu-96Tests 96 Tests
EUR 591
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Hu-48Tests 48 Tests
EUR 436
Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Hu-96Tests 96 Tests
EUR 601
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Mu-48Tests 48 Tests
EUR 447
Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Mu-96Tests 96 Tests
EUR 618
Rabbit HDGF ELISA Kit
ERTH0054 96Tests
EUR 521
Polyclonal HDGF Antibody (C-term)
APR05752G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal HDGF Antibody (C-term)
APR06952G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications:
HDGF Polyclonal Antibody, HRP Conjugated
A53045 100 µg
EUR 570.55
Description: reagents widely cited
HDGF Polyclonal Antibody, FITC Conjugated
A53046 100 µg
EUR 570.55
Description: Ask the seller for details
HDGF Polyclonal Antibody, Biotin Conjugated
A53047 100 µg
EUR 570.55
Description: The best epigenetics products
HDGF Antibody
ABD7289 100 ug
EUR 438
HDGF Antibody
32788-100ul 100ul
EUR 252
HDGF antibody
10R-1523 100 ug
EUR 512
Description: Mouse monoclonal HDGF antibody
HDGF antibody
70R-17711 50 ul
EUR 435
Description: Rabbit polyclonal HDGF antibody
HDGF Antibody
DF7289 200ul
EUR 304
Description: HDGF Antibody detects endogenous levels of total HDGF.
HDGF Antibody
1-CSB-PA01004A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA
HDGF Antibody
1-CSB-PA010249GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
HDGF Conjugated Antibody
C32788 100ul
EUR 397
anti- HDGF antibody
FNab03808 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: hepatoma-derived growth factor (high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 3068
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF
anti- HDGF antibody
FNab03809 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IF: 1:10-1:100
  • IHC: 1:50-1:500
  • Immunogen: hepatoma-derived growth factor(high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 81932
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF
Anti-HDGF Antibody
A01057 100ug/vial
EUR 334
Anti-HDGF antibody
PAab03808 100 ug
EUR 412
Anti-HDGF antibody
STJ98794 200 µl
EUR 197
Description: Rabbit polyclonal to HDGF.
Anti-HDGF antibody
STJ27300 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.
Anti-HDGF antibody
STJ115610 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.
Hdgf/ Rat Hdgf ELISA Kit
ELI-38905r 96 Tests
EUR 886
HDGF siRNA
20-abx902439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HDGF siRNA
20-abx919203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HDGF siRNA
20-abx919204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HDGF protein
30R-1402 100 ug
EUR 397
Description: Purified recombinant Human HDGF protein
pOTB7-HDGF
PVT14602 2 ug
EUR 495
anti-HDGF
YF-PA12275 50 ug
EUR 363
Description: Mouse polyclonal to HDGF
anti-HDGF
YF-PA23871 50 ul
EUR 334
Description: Mouse polyclonal to HDGF
HDGF Antibody, HRP conjugated
1-CSB-PA01004B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
HDGF Antibody, FITC conjugated
1-CSB-PA01004C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
HDGF Antibody, Biotin conjugated
1-CSB-PA01004D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human)
4-PAA624Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF)
HDGF cloning plasmid
CSB-CL010249HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctggg
  • Show more
Description: A cloning plasmid for the HDGF gene.
HDGF Blocking Peptide
DF7289-BP 1mg
EUR 195
pOTB7-HDGF Plasmid
PVTB00247S 2 ug
EUR 356
Anti-HDGF (2D6)
YF-MA13429 100 ug
EUR 363
Description: Mouse monoclonal to HDGF
HDGF Like 3 (HDGFL3) Antibody
20-abx327580
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC
4-PAA624Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Biotinylated
4-PAA624Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Cy3
4-PAA624Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), FITC
4-PAA624Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), HRP
4-PAA624Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), PE
4-PAA624Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse)
4-PAA624Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF)
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC-Cy7
4-PAA624Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC
4-PAA624Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA624Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA624Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), FITC
4-PAA624Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), HRP
4-PAA624Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP.
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), PE
4-PAA624Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx112980
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx128720
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx109863
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx103152
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
abx032817-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
abx032817-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx004089
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx172791
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx176825
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx176826
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Hepatoma Derived Growth Factor (HDGF) Antibody
abx233808-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
abx233809-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx225213
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rat HDGF shRNA Plasmid
20-abx987193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HDGF ELISA Kit
EHH0054 96Tests
EUR 521
Goat HDGF ELISA Kit
EGTH0054 96Tests
EUR 521
Bovine HDGF ELISA Kit
EBH0054 96Tests
EUR 521
Anserini HDGF ELISA Kit
EAH0054 96Tests
EUR 521
HDGF ELISA KIT|Human
EF010085 96 Tests
EUR 689
Porcine HDGF ELISA Kit
EPH0054 96Tests
EUR 521
Rat HDGF ELISA Kit
ERH0054 96Tests
EUR 521
Mouse HDGF ELISA Kit
EMH0054 96Tests
EUR 521
Mouse HDGF shRNA Plasmid
20-abx970772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HDGF shRNA Plasmid
20-abx952089
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HDGF Recombinant Protein (Human)
RP014515 100 ug Ask for price
pECMV-3-FLAG-HDGF
PVT14606 2 ug
EUR 495
HDGF Recombinant Protein (Rat)
RP204359 100 ug Ask for price
HDGF Recombinant Protein (Mouse)
RP141161 100 ug Ask for price
Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA624Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7.
Hepatoma Derived Growth Factor (HDGF) Antibody (HRP)
20-abx108345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody (Biotin)
20-abx105506
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Hepatoma Derived Growth Factor (HDGF) Antibody (FITC)
20-abx106923
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Hepatoma-Derived Growth Factor (HDGF) Antibody
32013-05111 150 ug
EUR 261
Guinea Pig HDGF ELISA Kit
EGH0054 96Tests
EUR 521
HDGF ORF Vector (Human) (pORF)
ORF004839 1.0 ug DNA
EUR 95
Hdgf ORF Vector (Rat) (pORF)
ORF068121 1.0 ug DNA
EUR 506
Hdgf ORF Vector (Mouse) (pORF)
ORF047055 1.0 ug DNA
EUR 506
pFastBac TM1 Signal-HDGF Plasmid
PVTB00247-2a 2 ug
EUR 356
HDGF ELISA Kit (Human) (OKCD00249)
OKCD00249 96 Wells
EUR 792
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"Hepatoma-derived growth factor binds DNA through the N-terminal PWWP domain."_x005F_x005F_x000D_Yang J., Everett A.D._x005F_x005F_x000D_BMC Mol. Biol. 8:101-101(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, DNA-BINDING. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL
Hdgf ELISA Kit (Mouse) (OKCD01531)
OKCD01531 96 Wells
EUR 779
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.4 pg/mL
HDGF ELISA Kit (Human) (OKAN06027)
OKAN06027 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL
HDGF sgRNA CRISPR Lentivector set (Human)
K0941201 3 x 1.0 ug
EUR 339
Hdgf sgRNA CRISPR Lentivector set (Mouse)
K4641401 3 x 1.0 ug
EUR 339
Mouse Hepatoma-derived growth factor (Hdgf)
1-CSB-YP010249MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Hepatoma-derived growth factor(Hdgf) expressed in Yeast
Hdgf sgRNA CRISPR Lentivector set (Rat)
K6948001 3 x 1.0 ug
EUR 339
Recombinant Hepatoma Derived Growth Factor (HDGF)
4-RPA624Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51858
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Hepatoma Derived Growth Factor expressed in: E.coli
Recombinant Hepatoma Derived Growth Factor (HDGF)
4-RPA624Mu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51859
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.8kDa
  • Isoelectric Point: 5.4
Description: Recombinant Mouse Hepatoma Derived Growth Factor expressed in: E.coli
Human Hepatoma-Derived Growth Factor (HDGF) Antibody (Biotin Conjugate)
32013-05121 150 ug
EUR 369
Rat Hepatoma Derived Growth Factor (HDGF) Protein
20-abx653734
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
HDGF sgRNA CRISPR Lentivector (Human) (Target 1)
K0941202 1.0 ug DNA
EUR 154
HDGF sgRNA CRISPR Lentivector (Human) (Target 2)
K0941203 1.0 ug DNA
EUR 154
HDGF sgRNA CRISPR Lentivector (Human) (Target 3)
K0941204 1.0 ug DNA
EUR 154
Mouse Hepatoma Derived Growth Factor (HDGF) Protein
20-abx067076
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Hepatoma Derived Growth Factor (HDGF) Protein
20-abx168070
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Hepatoma Derived Growth Factor (HDGF) Protein
20-abx261882
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4641402 1.0 ug DNA
EUR 154
Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4641403 1.0 ug DNA
EUR 154
Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4641404 1.0 ug DNA
EUR 154
Hdgf sgRNA CRISPR Lentivector (Rat) (Target 1)
K6948002 1.0 ug DNA
EUR 154
Hdgf sgRNA CRISPR Lentivector (Rat) (Target 2)
K6948003 1.0 ug DNA
EUR 154
Hdgf sgRNA CRISPR Lentivector (Rat) (Target 3)
K6948004 1.0 ug DNA
EUR 154
Recombinant Human HDGF Protein, Untagged, E.coli-1mg
QP12205-1mg 1mg
EUR 3655
Recombinant Human HDGF Protein, Untagged, E.coli-20ug
QP12205-20ug 20ug
EUR 201
Recombinant Human HDGF Protein, Untagged, E.coli-5ug
QP12205-5ug 5ug
EUR 155
HDGF Protein Vector (Rat) (pPB-C-His)
PV272482 500 ng
EUR 603
HDGF Protein Vector (Rat) (pPB-N-His)
PV272483 500 ng
EUR 603
HDGF Protein Vector (Rat) (pPM-C-HA)
PV272484 500 ng
EUR 603
HDGF Protein Vector (Rat) (pPM-C-His)
PV272485 500 ng
EUR 603
HDGF Protein Vector (Human) (pPB-C-His)
PV019353 500 ng
EUR 329
HDGF Protein Vector (Human) (pPB-N-His)
PV019354 500 ng
EUR 329
HDGF Protein Vector (Human) (pPM-C-HA)
PV019355 500 ng
EUR 329
HDGF Protein Vector (Human) (pPM-C-His)
PV019356 500 ng
EUR 329
HDGF Protein Vector (Mouse) (pPB-C-His)
PV188218 500 ng
EUR 603
HDGF Protein Vector (Mouse) (pPB-N-His)
PV188219 500 ng
EUR 603
HDGF Protein Vector (Mouse) (pPM-C-HA)
PV188220 500 ng
EUR 603
HDGF Protein Vector (Mouse) (pPM-C-His)
PV188221 500 ng
EUR 603
Hdgf 3'UTR Luciferase Stable Cell Line
TU205696 1.0 ml Ask for price
Hdgf 3'UTR GFP Stable Cell Line
TU159417 1.0 ml Ask for price
HDGF 3'UTR Luciferase Stable Cell Line
TU009672 1.0 ml
EUR 1394
Hdgf 3'UTR Luciferase Stable Cell Line
TU109417 1.0 ml Ask for price

HDGF Rabbit Polyclonal Antibody