COL19A1 Rabbit Polyclonal Antibody

COL19A1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

COL19A1 Polyclonal Antibody
46906-50ul 50ul
EUR 187
COL19A1 Polyclonal Antibody
ABP58227-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
COL19A1 Polyclonal Antibody
ABP58227-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
COL19A1 Polyclonal Antibody
ABP58227-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
COL19A1 Polyclonal Antibody
ABP53760-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
COL19A1 Polyclonal Antibody
ABP53760-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
COL19A1 Polyclonal Antibody
ABP53760-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
COL19A1 Polyclonal Antibody
ES4759-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
COL19A1 Polyclonal Antibody
ES4759-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
COL19A1 Polyclonal Antibody
ES8856-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
COL19A1 Polyclonal Antibody
ES8856-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
COL19A1 Polyclonal Conjugated Antibody
C46906 100ul
EUR 397
COL19A1 Antibody
44308-100ul 100ul
EUR 252
COL19A1 Antibody
44308-50ul 50ul
EUR 187
COL19A1 Antibody
1-CSB-PA325870
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
COL19A1 Antibody
CSB-PA213241-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500
COL19A1 Antibody
CSB-PA213241-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500
COL19A1 Antibody
1-CSB-PA007137
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
COL19A1 Antibody
AF9044 200ul
EUR 304
Description: COL19A1 Antibody detects endogenous levels of total COL19A1.
COL19A1 Antibody
ABF9044 100 ug
EUR 438
COL19A1 Conjugated Antibody
C44308 100ul
EUR 397
Anti-COL19A1 antibody
STJ92382 200 µl
EUR 197
Description: Rabbit polyclonal to COL19A1.
Anti-COL19A1 antibody
STJ99329 200 µl
EUR 197
Description: Rabbit polyclonal to COL19A1.
COL19A1 siRNA
20-abx912404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
COL19A1 siRNA
20-abx912405
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-COL19A1
YF-PA23489 50 ul
EUR 334
Description: Mouse polyclonal to COL19A1
COL19A1 Blocking Peptide
20-abx061072
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
COL19A1 cloning plasmid
CSB-CL614819HU-10ug 10ug
EUR 1252
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3429
  • Sequence: ATGAGACTCACTGGCCCTTGGAAACTTTGGCTTTGGATGTCAATATTTCTGCTTCCTGCTTCCACTTCCGTGACCGTTAGGGACAAGACAGAAGAGTCATGCCCTATCCTGAGAATAGAGGGACATCAGCTGACATATGACAACATAAACAAACTTGAAGTTTCAGGTTTTGATC
  • Show more
Description: A cloning plasmid for the COL19A1 gene.
COL19A1 Blocking Peptide
AF9044-BP 1mg
EUR 195
Mouse COL19A1 shRNA Plasmid
20-abx969753
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human COL19A1 shRNA Plasmid
20-abx950922
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit
E04C1898-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit
E04C1898-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit
E04C1898-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
20-abx133490
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
20-abx149451
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
20-abx013964
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
abx030632-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
abx030632-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
COL19A1 ORF Vector (Human) (pORF)
ORF012738 1.0 ug DNA
EUR 354
Col19a1 ORF Vector (Mouse) (pORF)
ORF041763 1.0 ug DNA
EUR 506
Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody
abx330322-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody
20-abx324795
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody
20-abx324993
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
COL19A1 sgRNA CRISPR Lentivector set (Human)
K0485401 3 x 1.0 ug
EUR 339
Col19a1 sgRNA CRISPR Lentivector set (Mouse)
K3650901 3 x 1.0 ug
EUR 339
COL19A1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0485402 1.0 ug DNA
EUR 154
COL19A1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0485403 1.0 ug DNA
EUR 154
COL19A1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0485404 1.0 ug DNA
EUR 154
Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3650902 1.0 ug DNA
EUR 154
Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3650903 1.0 ug DNA
EUR 154

COL19A1 Rabbit Polyclonal Antibody

 

Apex Business WordPress Theme | Designed by Crafthemes