CDKN3 Rabbit Polyclonal Antibody

CDKN3 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CDKN3 Polyclonal Antibody
ES4465-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CDKN3 Polyclonal Antibody
ABP58093-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein

CDKN3 Polyclonal Antibody
ABP58093-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein

CDKN3 Polyclonal Antibody
ABP58093-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein

CDKN3 Polyclonal Antibody
ABP53466-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80

CDKN3 Polyclonal Antibody
ABP53466-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80

CDKN3 Polyclonal Antibody
ABP53466-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80

CDKN3 Polyclonal Antibody
40724-100ul 100ul
EUR 252

CDKN3 Polyclonal Antibody
40724-50ul 50ul
EUR 187

CDKN3 Rabbit pAb
A2061-100ul 100 ul
EUR 308

CDKN3 Rabbit pAb
A2061-200ul 200 ul
EUR 459

CDKN3 Rabbit pAb
A2061-20ul 20 ul
EUR 183

CDKN3 Rabbit pAb
A2061-50ul 50 ul
EUR 223

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
DLR-CDKN3-Hu-48T 48T
EUR 517
  • Should the Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in samples from tissue homogenates or other biological fluids.

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
DLR-CDKN3-Hu-96T 96T
EUR 673
  • Should the Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in samples from tissue homogenates or other biological fluids.

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
RD-CDKN3-Hu-48Tests 48 Tests
EUR 521

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
RD-CDKN3-Hu-96Tests 96 Tests
EUR 723

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
RDR-CDKN3-Hu-48Tests 48 Tests
EUR 544

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
RDR-CDKN3-Hu-96Tests 96 Tests
EUR 756

CDKN3 antibody
70R-5506 50 ug
EUR 467
Description: Rabbit polyclonal CDKN3 antibody

CDKN3 antibody
70R-31929 100 ug
EUR 327
Description: Rabbit polyclonal CDKN3 antibody

CDKN3 Antibody
ABD6791 100 ug
EUR 438

CDKN3 Antibody
32578-100ul 100ul
EUR 252

CDKN3 antibody
10R-3660 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody
10R-3661 100 ul
EUR 726
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody
10R-3662 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody
10R-3663 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody
10R-3664 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody
10R-3665 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody
10R-3666 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 Antibody
DF6791 200ul
EUR 304
Description: CDKN3 Antibody detects endogenous levels of total CDKN3.

CDKN3 Antibody
CSB-PA005096KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDKN3 Antibody
CSB-PA005096KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDKN3 Antibody
1-CSB-PA005096LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CDKN3 Antibody
1-CSB-PA006489
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Polyclonal Cdkn3 antibody - N-terminal region
APR01218G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdkn3 - N-terminal region. This antibody is tested and proven to work in the following applications:

CDKN3 Conjugated Antibody
C32578 100ul
EUR 397

Anti-CDKN3 Antibody
A05157 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CDKN3 Antibody (CDKN3) detection.tested for WB in Human, Mouse.

Anti-CDKN3 antibody
STJ92208 200 µl
EUR 197
Description: Rabbit polyclonal to CDKN3.

Anti-CDKN3 antibody
STJ99640 200 µl
EUR 197
Description: Rabbit polyclonal to CDKN3.

Anti-CDKN3 antibody
STJ23083 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Cdkn3/ Rat Cdkn3 ELISA Kit
ELI-10082r 96 Tests
EUR 886

CDKN3 siRNA
20-abx900980
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDKN3 siRNA
20-abx911332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDKN3 siRNA
20-abx911333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CDKN3
YF-PA10887 50 ul
EUR 363
Description: Mouse polyclonal to CDKN3

anti-CDKN3
YF-PA10888 50 ug
EUR 363
Description: Mouse polyclonal to CDKN3

anti-CDKN3
YF-PA23429 50 ul
EUR 334
Description: Mouse polyclonal to CDKN3

CDKN3 Antibody, HRP conjugated
1-CSB-PA005096LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDKN3 Antibody, FITC conjugated
1-CSB-PA005096LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDKN3 Antibody, Biotin conjugated
1-CSB-PA005096LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDKN3 cloning plasmid
CSB-CL005096HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgaagccgcccagttcaatacaaacaagttgtaaatttaaagatgttagaagaaatgtccaaaaagatacagaagaactaaagagctgtggtatacaagacatatttgttttctgcaccagaggggaactgtcaaaatatagagtcccaaaccttctggatctctaccagcaatg
  • Show more
Description: A cloning plasmid for the CDKN3 gene.

CDKN3 Blocking Peptide
33R-1720 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDKN3 antibody, catalog no. 70R-5506

CDKN3 Blocking Peptide
DF6791-BP 1mg
EUR 195

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human)
4-PAC368Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3)

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), APC
4-PAC368Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with APC.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), Biotinylated
4-PAC368Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with Biotin.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), Cy3
4-PAC368Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with Cy3.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), FITC
4-PAC368Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with FITC.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), HRP
4-PAC368Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with HRP.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), PE
4-PAC368Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with PE.

CDKN3 Cell ELISA Kit
abx595870-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse CDKN3 shRNA Plasmid
20-abx977752
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CDKN3 shRNA Plasmid
20-abx988421
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDKN3 ELISA KIT|Human
EF006681 96 Tests
EUR 689

Human CDKN3 shRNA Plasmid
20-abx950746
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDKN3 protein (His tag)
80R-1586 100 ug
EUR 397
Description: Purified recombinant Human CDKN3 protein

CDKN3 Recombinant Protein (Human)
RP006694 100 ug Ask for price

CDKN3 Recombinant Protein (Rat)
RP194390 100 ug Ask for price

CDKN3 Recombinant Protein (Mouse)
RP123212 100 ug Ask for price

Rabbit Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit
abx363507-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit
E04C1578-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit
E04C1578-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit
E04C1578-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), APC-Cy7
4-PAC368Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with APC-Cy7.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
20-abx128074
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
abx117191-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
20-abx001678
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
abx033454-400ul 400 ul
EUR 551
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
abx033454-80l 80 µl
EUR 321
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
20-abx325855
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
20-abx333837
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
20-abx225100
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody
20-abx171985
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

CDKN3 Colorimetric Cell-Based ELISA
EKC1837 100ul
EUR 572

CDKN3 ORF Vector (Human) (pORF)
ORF002232 1.0 ug DNA
EUR 95

Cdkn3 ORF Vector (Mouse) (pORF)
ORF041072 1.0 ug DNA
EUR 506

Cdkn3 ORF Vector (Rat) (pORF)
ORF064798 1.0 ug DNA
EUR 506

CDKN3 ELISA Kit (Human) (OKCD01665)
OKCD01665 96 Wells
EUR 831
Description: Description of target: May play a role in cell cycle regulation. Dual specificity phosphatase active toward substrates containing either phosphotyrosine or phosphoserine residues. Dephosphorylates CDK2 at 'Thr-160' in a cyclin-dependent manner.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (HRP)
20-abx335232
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (FITC)
20-abx335233
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (Biotin)
20-abx335234
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CDKN3 sgRNA CRISPR Lentivector set (Human)
K0420501 3 x 1.0 ug
EUR 339

Cdkn3 sgRNA CRISPR Lentivector set (Mouse)
K3512801 3 x 1.0 ug
EUR 339

Cdkn3 sgRNA CRISPR Lentivector set (Rat)
K6267201 3 x 1.0 ug
EUR 339

CDKN3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0420502 1.0 ug DNA
EUR 154

CDKN3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0420503 1.0 ug DNA
EUR 154

CDKN3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0420504 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3512802 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3512803 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3512804 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6267202 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6267203 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6267204 1.0 ug DNA
EUR 154

Human Cyclin-dependent kinase inhibitor 3 (CDKN3)
1-CSB-YP005096HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cyclin-dependent kinase inhibitor 3(CDKN3) expressed in Yeast

Recombinant Cyclin Dependent Kinase Inhibitor 3 (CDKN3)
4-RPC368Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16667
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cyclin Dependent Kinase Inhibitor 3 expressed in: E.coli

Recombinant Human CDKN3 Protein, His, E.coli-1mg
QP11379-1mg 1mg
EUR 3655

Recombinant Human CDKN3 Protein, His, E.coli-20ug
QP11379-20ug 20ug
EUR 201

Recombinant Human CDKN3 Protein, His, E.coli-5ug
QP11379-5ug 5ug
EUR 155

CDKN3 Protein Vector (Human) (pPB-C-His)
PV008925 500 ng
EUR 329

CDKN3 Protein Vector (Human) (pPB-N-His)
PV008926 500 ng
EUR 329

CDKN3 Protein Vector (Human) (pPM-C-HA)
PV008927 500 ng
EUR 329

CDKN3 Protein Vector (Human) (pPM-C-His)
PV008928 500 ng
EUR 329

CDKN3 Protein Vector (Rat) (pPB-C-His)
PV259190 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPB-N-His)
PV259191 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPM-C-HA)
PV259192 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPM-C-His)
PV259193 500 ng
EUR 603

CDKN3 Rabbit Polyclonal Antibody

 

Apex Business WordPress Theme | Designed by Crafthemes