FAP-1 Rabbit Polyclonal Antibody

FAP-1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

FAP-1 Polyclonal Antibody
ES8916-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAP-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
FAP-1 Polyclonal Antibody
ABP58529-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FAP-1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAP-1 from Human, Mouse, Rat. This FAP-1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAP-1 protein
FAP-1 Polyclonal Antibody
ABP58529-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FAP-1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAP-1 from Human, Mouse, Rat. This FAP-1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAP-1 protein
FAP-1 Polyclonal Antibody
ABP58529-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FAP-1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FAP-1 from Human, Mouse, Rat. This FAP-1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAP-1 protein
FAP-1 Antibody
AF0739 200ul
EUR 304
Description: FAP-1 Antibody detects endogenous levels of FAP-1.
FAP 1 Antibody
abx149914-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
FAP-1 Antibody
abx011419-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
FAP 1 Antibody
ABF5344 100 ug
EUR 438
FAP- 1 Antibody
ABF0739 100 ug
EUR 438
FAP-1 Antibody
33369-100ul 100ul
EUR 252
FAP-1 Antibody
33369-50ul 50ul
EUR 187
Rabbit Anti Human Fap Alpha Polyclonal Antibody
CPBT-67607RH 50 µg
EUR 985
FAP Rabbit pAb
A6349-100ul 100 ul
EUR 308
FAP Rabbit pAb
A6349-200ul 200 ul
EUR 459
FAP Rabbit pAb
A6349-20ul 20 ul
EUR 183
FAP Rabbit pAb
A6349-50ul 50 ul
EUR 223
Prolyl Endopeptidase FAP (FAP) Antibody
abx036651-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Prolyl Endopeptidase FAP (FAP) Antibody
20-abx004852
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prolyl Endopeptidase FAP (Fap) Antibody
abx031162-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Prolyl Endopeptidase FAP (Fap) Antibody
abx031162-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Prolyl Endopeptidase FAP (FAP) Antibody
abx026875-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Prolyl Endopeptidase FAP (FAP) Antibody
abx026875-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Prolyl Endopeptidase FAP (FAP) Antibody
20-abx320182
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
FAP-1 Conjugated Antibody
C33369 100ul
EUR 397
Anti-FAP-1 antibody
STJ99634 200 µl
EUR 197
Description: Rabbit polyclonal to FAP-1.
Anti-Fibroblast activation protein, alpha/FAP Antibody
A00422-1 100ug/vial
EUR 294
Polyclonal FAP-1 / PTPN13 Antibody (aa2290-2491)
APR02561G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP-1 / PTPN13 (aa2290-2491). This antibody is tested and proven to work in the following applications:
FAP Antibody
36465-100ul 100ul
EUR 252
FAP antibody
20R-FR012 50 ug
EUR 656
Description: Rabbit polyclonal FAP antibody
FAP Antibody
1-CSB-PA949422
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
FAP Antibody
1-CSB-PA008191
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
FAP Antibody
1-CSB-PA614259ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FAP. Recognizes FAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
FAP Antibody
1-CSB-PA699536
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
FAP Antibody
CSB-PA101830-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
FAP Antibody
CSB-PA101830-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAP. Recognizes FAP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
Polyclonal FAP Alpha Antibody (Internal)
APR02692G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP Alpha (Internal). This antibody is tested and proven to work in the following applications:
FAP
EF006808 96 Tests
EUR 689
Polyclonal FAP Alpha Antibody (Extracellular Domain)
APR02074G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP Alpha (Extracellular Domain). This antibody is tested and proven to work in the following applications:
Polyclonal FAP Alpha Antibody (Extracellular Domain)
APR02075G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAP Alpha (Extracellular Domain). This antibody is tested and proven to work in the following applications:
Polyclonal Mouse Fap Antibody(N-term)
APR04457G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Fap (N-term). This antibody is tested and proven to work in the following applications:
FAP Conjugated Antibody
C36465 100ul
EUR 397
FAP alpha Antibody
20-abx134947
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Seprase (FAP) Antibody
20-abx328406
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Seprase (FAP) Antibody
abx331563-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Seprase (FAP) Antibody
20-abx212884
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Seprase (FAP) Antibody
20-abx212885
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-FAP antibody
STJ28432 100 µl
EUR 277
Description: The protein encoded by this gene is a homodimeric integral membrane gelatinase belonging to the serine protease family. It is selectively expressed in reactive stromal fibroblasts of epithelial cancers, granulation tissue of healing wounds, and malignant cells of bone and soft tissue sarcomas. This protein is thought to be involved in the control of fibroblast growth or epithelial-mesenchymal interactions during development, tissue repair, and epithelial carcinogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Mouse Prolyl endopeptidase FAP (Fap)
1-CSB-CF008424MO
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 101.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Prolyl endopeptidase FAP(Fap),partial expressed in in vitro E.coli expression system
FAP-1 Blocking Peptide
AF0739-BP 1mg
EUR 195
FAP siRNA
20-abx916480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FAP siRNA
20-abx916481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-FAP
YF-PA27225 100 ul
EUR 403
Description: Rabbit polyclonal to FAP
Mouse Fap/ Prolyl endopeptidase FAP ELISA Kit
E0506Mo 1 Kit
EUR 632
Human FAP/ Prolyl endopeptidase FAP ELISA Kit
E0862Hu 1 Kit
EUR 605
FAP-1 Cell ELISA Kit
abx595219-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
FAP cloning plasmid
CSB-CL614259HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: atgaagacttgggtaaaaatcgtatttggagttgccacctctgctgtgcttgccttattggtgatgtgcattgtcttacgcccttcaagagttcataactctgaagaaaatacaatgagagcactcacactgaaggatattttaaatggaacattttcttataaaacattttttc
  • Show more
Description: A cloning plasmid for the FAP gene.
Rabbit Polyclonal Antibody to Human Topoisomerase IIα
TG2011-1 250 units
EUR 414
Polyclonal Rabbit anti-sEH
SEH-1 50 uL
EUR 280
Fap ELISA Kit| Mouse Prolyl endopeptidase FAP ELISA Kit
EF014918 96 Tests
EUR 689
Anti-Sumo 1 Rabbit Monoclonal Antibody
M00631-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo 1 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Cytokeratin 1 Rabbit Monoclonal Antibody
M01639-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Fibroblast Activation Protein Alpha (FAP) Antibody
abx411932-50ug 50 ug
EUR 704
  • Shipped within 1 week.
FAP ELISA KIT|Human
EF004980 96 Tests
EUR 689
FAP alpha Blocking Peptide
20-abx061646
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Human FAP shRNA Plasmid
20-abx951527
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse FAP shRNA Plasmid
20-abx970281
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
FAP Recombinant Protein (Human)
RP011767 100 ug Ask for price
FAP Recombinant Protein (Rat)
RP200843 100 ug Ask for price
FAP Recombinant Protein (Mouse)
RP133745 100 ug Ask for price
Anti-HMGB1/Hmg 1 Rabbit Monoclonal Antibody
M00066-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal HMGB1/Hmg 1 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-p27 KIP 1 Rabbit Monoclonal Antibody
M00173-1 100ug/vial
EUR 397
Description: Anti-p27 KIP 1 Rabbit Monoclonal Antibody tested for Flow Cytometry, IP, IF, IHC, ICC, WB in Human, Rat
Anti-MHC class 1 Rabbit Monoclonal Antibody
M00194-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MHC class 1 Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-Integrin beta 1 Rabbit Monoclonal Antibody
M00772-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Integrin beta 1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-ARG1/Arginase 1 Rabbit Monoclonal Antibody
M01106-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal ARG1/Arginase 1 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-MLANA/Mart 1 Rabbit Monoclonal Antibody
M02033-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MLANA/Mart 1 Antibody. Validated in IF, WB and tested in Human.
Anti-DSG1/Desmoglein 1 Rabbit Monoclonal Antibody
M02655-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal DSG1/Desmoglein 1 Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
FAP-1 Colorimetric Cell-Based ELISA Kit
EKC1209 100ul
EUR 572
FAP sgRNA CRISPR Lentivector (Human) (Target 1)
K0757602 1.0 ug DNA
EUR 154
Fap sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3418002 1.0 ug DNA
EUR 154
Fap sgRNA CRISPR Lentivector (Rat) (Target 1)
K6953402 1.0 ug DNA
EUR 154
Anti-BOB-1/OBF-1 Rabbit Monoclonal Antibody, Clone#RM378
M04431-1 100uL
EUR 385
Description: Anti-BOB-1/OBF-1 Rabbit Monoclonal Antibody, Clone#RM378 tested in WB, IHC, reactive to Human
Anti-AFP/Alpha 1 Fetoprotein Rabbit Monoclonal Antibody
M00522-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal AFP/Alpha 1 Fetoprotein Antibody. Validated in IP, IF, WB and tested in Human.
Anti-SERPINA1/Alpha 1 Antitrypsin Rabbit Monoclonal Antibody
M00720-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal SERPINA1/Alpha 1 Antitrypsin Antibody. Validated in IP, IF, WB and tested in Human.
Anti-GPX1/Glutathione Peroxidase 1 Rabbit Monoclonal Antibody
M01019-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal GPX1/Glutathione Peroxidase 1 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-BAG-1 Rabbit Monoclonal Antibody, Clone#RM356
M02423-1 100uL
EUR 385
Description: Anti-BAG-1 Rabbit Monoclonal Antibody, Clone#RM356 tested in WB, IHC, reactive to Human
Monoclonal FAP Antibody (monoclonal) (M01), Clone: 1E6
AMM03518G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FAP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E6. This antibody is applicable in WB, IP, E
Anti-Fibroblast activation protein, alpha/FAP Antibody
PA1913 100ug/vial
EUR 334
FAP-1 Colorimetric Cell-Based ELISA Kit (OKAG00709)
OKAG00709 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
Anti-Phospho-AMPK alpha 1 (S496) Rabbit Monoclonal Antibody
P00994-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-AMPK alpha 1 (S496) Antibody. Validated in IP, IF, WB and tested in Human.
Human Seprase (FAP) ELISA Kit
abx555418-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Seprase (FAP) ELISA Kit
abx555647-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Anti-FAP-SMCC-DM1 ADC
ADC-W-593 1mg Ask for price
Description: This ADC product is comprised of an anti-FAP monoclonal antibody conjugated via a SMCC linker to DM1
Mouse Seprase, Fap ELISA KIT
ELI-18340m 96 Tests
EUR 865
Human Seprase, FAP ELISA KIT
ELI-40989h 96 Tests
EUR 824
Human Seprase (FAP),
1-CSB-EP008424HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 112 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Seprase(FAP),partial expressed in E.coli
Human Seprase(FAP) ELISA kit
CSB-EL008424HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Seprase (FAP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Seprase(FAP) ELISA kit
1-CSB-EL008424HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Seprase(FAP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Seprase(FAP) ELISA kit
CSB-EL008424MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Seprase (FAP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Seprase(FAP) ELISA kit
1-CSB-EL008424MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Seprase(FAP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
FAP ORF Vector (Human) (pORF)
ORF003923 1.0 ug DNA
EUR 95
Recombinant mouse Prolyl endopeptidase FAP
P1417 100ug Ask for price
  • Uniprot ID: P97321
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Prolyl endopeptidase FAP
Fap ORF Vector (Rat) (pORF)
ORF066949 1.0 ug DNA
EUR 506
Fap ORF Vector (Mouse) (pORF)
ORF044583 1.0 ug DNA
EUR 506
FAP ELISA Kit (Mouse) (OKCD00760)
OKCD00760 96 Wells
EUR 857
Description: Description of target: Cell surface glycoprotein serine protease that participates in extracellular matrix degradation and involved in many cellular processes including tissue remodeling, fibrosis, wound healing, inflammation and tumor growth. Both plasma membrane and soluble forms exhibit post-proline cleaving endopeptidase activity, with a marked preference for Ala/Ser-Gly-Pro-Ser/Asn/Ala consensus sequences, on substrate such as alpha-2-antiplasmin SERPINF2 and SPRY2. Degrade also gelatin, heat-denatured type I collagen, but not native collagen type I and IV, vibronectin, tenascin, laminin, fibronectin, fibrin or casein. Have also dipeptidyl peptidase activity, exhibiting the ability to hydrolyze the prolyl bond two residues from the N-terminus of synthetic dipeptide substrates provided that the penultimate residue is proline, with a preference for Ala-Pro, Ile-Pro, Gly-Pro, Arg-Pro and Pro-Pro. Natural neuropeptide hormones for dipeptidyl peptidase are the neuropeptide Y (NPY), peptide YY (PYY), substance P (TAC1) and brain natriuretic peptide 32 (NPPB). The plasma membrane form, in association with either DPP4, PLAUR or integrins, is involved in the pericellular proteolysis of the extracellular matrix (ECM), and hence promotes cell adhesion, migration and invasion through the ECM. Plays a role in tissue remodeling during development and wound healing. Participates in the cell invasiveness towards the ECM in malignant melanoma cancers. Enhances tumor growth progression by increasing angiogenesis, collagen fiber degradation and apoptosis and by reducing antitumor response of the immune system. Promotes glioma cell invasion through the brain parenchyma by degrading the proteoglycan brevican. Acts as a tumor suppressor in melanocytic cells through regulation of cell proliferation and survival in a serine protease activity-independent manner.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL
FAP ELISA Kit (Mouse) (OKAN06455)
OKAN06455 96 Wells
EUR 792
Description: Description of target: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13.4 pg/mL
FAP ELISA Kit (Human) (OKCD08143)
OKCD08143 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a homodimeric integral membrane gelatinase belonging to the serine protease family. It is selectively expressed in reactive stromal fibroblasts of epithelial cancers, granulation tissue of healing wounds, and malignant cells of bone and soft tissue sarcomas. This protein is thought to be involved in the control of fibroblast growth or epithelial-mesenchymal interactions during development, tissue repair, and epithelial carcinogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL
FAP ELISA Kit (Human) (OKEH03627)
OKEH03627 96 Wells
EUR 779
Description: Description of target: Cell surface glycoprotein serine protease that participates in extracellular matrix degradation and involved in many cellular processes including tissue remodeling, fibrosis, wound healing, inflammation and tumor growth. Both plasma membrane and soluble forms exhibit post-proline cleaving endopeptidase activity, with a marked preference for Ala/Ser-Gly-Pro-Ser/Asn/Ala consensus sequences, on substrate such as alpha-2-antiplasmin SERPINF2 and SPRY2 (PubMed:14751930, PubMed:16223769, PubMed:16480718, PubMed:16410248, PubMed:17381073, PubMed:18095711, PubMed:21288888, PubMed:24371721). Degrade also gelatin, heat-denatured type I collagen, but not native collagen type I and IV, vibronectin, tenascin, laminin, fibronectin, fibrin or casein (PubMed:9065413, PubMed:2172980, PubMed:7923219, PubMed:10347120, PubMed:10455171, PubMed:12376466, PubMed:16223769, PubMed:16651416, PubMed:18095711). Have also dipeptidyl peptidase activity, exhibiting the ability to hydrolyze the prolyl bond two residues from the N-terminus of synthetic dipeptide substrates provided that the penultimate residue is proline, with a preference for Ala-Pro, Ile-Pro, Gly-Pro, Arg-Pro and Pro-Pro (PubMed:10347120, PubMed:10593948, PubMed:16175601, PubMed:16223769, PubMed:16651416, PubMed:16410248, PubMed:17381073, PubMed:21314817, PubMed:24371721, PubMed:24717288). Natural neuropeptide hormones for dipeptidyl peptidase are the neuropeptide Y (NPY), peptide YY (PYY), substance P (TAC1) and brain natriuretic peptide 32 (NPPB) (PubMed:21314817). The plasma membrane form, in association with either DPP4, PLAUR or integrins, is involved in the pericellular proteolysis of the extracellular matrix (ECM), and hence promotes cell adhesion, migration and invasion through the ECM. Plays a role in tissue remodeling during development and wound healing. Participates in the cell invasiveness towards the ECM in malignant melanoma cancers. Enhances tumor growth progression by increasing angiogenesis, collagen fiber degradation and apoptosis and by reducing antitumor response of the immune system. Promotes glioma cell invasion through the brain parenchyma by degrading the proteoglycan brevican. Acts as a tumor suppressor in melanocytic cells through regulation of cell proliferation and survival in a serine protease activity-independent manner.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL
Helicobacter Pylori; Rabbit Polyclonal (Concentrate)
RA0379-C.1 0.1 ml
EUR 125
Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-100ul 100ul
EUR 252
Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-50ul 50ul
EUR 187
Rabbit polyclonal METTL8(1) antibody
40013-100ul 100ul
EUR 390

FAP-1 Rabbit Polyclonal Antibody