PEX14 Rabbit Polyclonal Antibody

PEX14 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

PEX14 Polyclonal Antibody
ES8932-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PEX14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PEX14 Polyclonal Antibody
ABP59881-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PEX14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PEX14 from Human, Mouse, Rat. This PEX14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX14 protein
PEX14 Polyclonal Antibody
ABP59881-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PEX14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PEX14 from Human, Mouse, Rat. This PEX14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX14 protein
PEX14 Polyclonal Antibody
ABP59881-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PEX14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PEX14 from Human, Mouse, Rat. This PEX14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX14 protein
PEX14 Rabbit pAb
A7336-100ul 100 ul
EUR 308
PEX14 Rabbit pAb
A7336-200ul 200 ul
EUR 459
PEX14 Rabbit pAb
A7336-20ul 20 ul
EUR 183
PEX14 Rabbit pAb
A7336-50ul 50 ul
EUR 223
Polyclonal PEX14 Antibody (Center)
AMM07100G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PEX14 (Center). This antibody is tested and proven to work in the following applications:
PEX14 antibody
70R-50193 100 ul
EUR 244
Description: Purified Polyclonal PEX14 antibody
PEX14 Antibody
ABD4284 100 ug
EUR 438
PEX14 Antibody
34892-100ul 100ul
EUR 252
PEX14 Antibody
34892-50ul 50ul
EUR 187
PEX14 antibody
70R-19219 50 ul
EUR 435
Description: Rabbit polyclonal PEX14 antibody
PEX14 Antibody
DF4284 200ul
EUR 304
Description: PEX14 Antibody detects endogenous levels of total PEX14.
PEX14 Antibody
1-CSB-PA867033LA01DOA
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
PEX14 Antibody
1-CSB-PA003741
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
PEX14 Antibody
CSB-PA775947-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
PEX14 Antibody
CSB-PA775947-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
PEX14 Antibody
1-CSB-PA017800ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PEX14 Antibody
1-CSB-PA017800ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PEX14 Antibody
1-CSB-PA017800GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF
Pex14/ Rat Pex14 ELISA Kit
ELI-20908r 96 Tests
EUR 886
PEX14 Conjugated Antibody
C34892 100ul
EUR 397
anti- PEX14 antibody
FNab06327 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: peroxisomal biogenesis factor 14
  • Uniprot ID: O75381
  • Gene ID: 5195
  • Research Area: Signal Transduction
Description: Antibody raised against PEX14
Anti-PEX14 Antibody
A03327 100ul
EUR 397
Description: Rabbit Polyclonal PEX14 Antibody. Validated in IHC, WB and tested in Human, Mouse.
Anti-PEX14 antibody
PAab06327 100 ug
EUR 355
Anti-PEX14 antibody
STJ99650 200 µl
EUR 197
Description: Rabbit polyclonal to PEX14.
Anti-PEX14 antibody
STJ29475 100 µl
EUR 277
Description: This gene encodes an essential component of the peroxisomal import machinery. The protein is integrated into peroxisome membranes with its C-terminus exposed to the cytosol, and interacts with the cytosolic receptor for proteins containing a PTS1 peroxisomal targeting signal. The protein also functions as a transcriptional corepressor and interacts with a histone deacetylase. A mutation in this gene results in one form of Zellweger syndrome.
PEX14 siRNA
20-abx903947
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEX14 siRNA
20-abx928278
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEX14 siRNA
20-abx928279
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PEX14
YF-PA13722 50 ug
EUR 363
Description: Mouse polyclonal to PEX14
PEX14 Antibody, HRP conjugated
1-CSB-PA867033LB01DOA
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is HRP conjugated. Tested in the following application: ELISA
PEX14 Antibody, FITC conjugated
1-CSB-PA867033LC01DOA
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is FITC conjugated. Tested in the following application: ELISA
PEX14 Antibody, Biotin conjugated
1-CSB-PA867033LD01DOA
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX14. Recognizes PEX14 from Arabidopsis thaliana. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human Peroxisomal membrane protein PEX14, PEX14 ELISA KIT
ELI-35662h 96 Tests
EUR 824
Mouse Peroxisomal membrane protein PEX14, Pex14 ELISA KIT
ELI-37738m 96 Tests
EUR 865
PEX14 cloning plasmid
CSB-CL017800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcgtcctcggagcaggcagagcagccgagccagccaagctctactccaggaagtgaaaatgtgctgcctcgagagccgctgattgccacggcagtgaagtttctacagaattcccgggtccgccagagcccacttgcaaccaggagagcattcctaaagaagaaagggctga
  • Show more
Description: A cloning plasmid for the PEX14 gene.
PEX14 Blocking Peptide
20-abx063068
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
PEX14 Blocking Peptide
DF4284-BP 1mg
EUR 195
Anti-PEX14 (1G12)
YF-MA14671 100 ug
EUR 363
Description: Mouse monoclonal to PEX14
Mouse PEX14 shRNA Plasmid
20-abx974669
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat PEX14 shRNA Plasmid
20-abx986246
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PEX14 ELISA KIT|Human
EF001689 96 Tests
EUR 689
Human PEX14 shRNA Plasmid
20-abx953467
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PEX14 Recombinant Protein (Human)
RP023131 100 ug Ask for price
PEX14 Recombinant Protein (Rat)
RP220085 100 ug Ask for price
PEX14 Recombinant Protein (Mouse)
RP161384 100 ug Ask for price
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx114405
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx036238-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx034246-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx034246-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx008877
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx006919
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx026888-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx026888-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx014702
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • EUR 70.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • 5 ug
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx320904
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx320905
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
20-abx328657
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx331597-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Peroxisomal Biogenesis Factor 14 (PEX14) Antibody
abx236327-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
PEX14 ORF Vector (Human) (pORF)
ORF007711 1.0 ug DNA
EUR 95
Pex14 ORF Vector (Rat) (pORF)
ORF073363 1.0 ug DNA
EUR 506
Pex14 ORF Vector (Mouse) (pORF)
ORF053796 1.0 ug DNA
EUR 506
PEX14 sgRNA CRISPR Lentivector set (Human)
K1629701 3 x 1.0 ug
EUR 339
Pex14 sgRNA CRISPR Lentivector set (Mouse)
K4712301 3 x 1.0 ug
EUR 339
Pex14 sgRNA CRISPR Lentivector set (Rat)
K7067601 3 x 1.0 ug
EUR 339
PEX14 sgRNA CRISPR Lentivector (Human) (Target 1)
K1629702 1.0 ug DNA
EUR 154
PEX14 sgRNA CRISPR Lentivector (Human) (Target 2)
K1629703 1.0 ug DNA
EUR 154
PEX14 sgRNA CRISPR Lentivector (Human) (Target 3)
K1629704 1.0 ug DNA
EUR 154
Pex14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4712302 1.0 ug DNA
EUR 154
Pex14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4712303 1.0 ug DNA
EUR 154
Pex14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4712304 1.0 ug DNA
EUR 154
Pex14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7067602 1.0 ug DNA
EUR 154
Pex14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7067603 1.0 ug DNA
EUR 154
Pex14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7067604 1.0 ug DNA
EUR 154
PEX14 Protein Vector (Human) (pPB-C-His)
PV030841 500 ng
EUR 329
PEX14 Protein Vector (Human) (pPB-N-His)
PV030842 500 ng
EUR 329
PEX14 Protein Vector (Human) (pPM-C-HA)
PV030843 500 ng
EUR 329
PEX14 Protein Vector (Human) (pPM-C-His)
PV030844 500 ng
EUR 329
PEX14 Protein Vector (Mouse) (pPB-C-His)
PV215182 500 ng
EUR 603
PEX14 Protein Vector (Mouse) (pPB-N-His)
PV215183 500 ng
EUR 603
PEX14 Protein Vector (Mouse) (pPM-C-HA)
PV215184 500 ng
EUR 603
PEX14 Protein Vector (Mouse) (pPM-C-His)
PV215185 500 ng
EUR 603
PEX14 Protein Vector (Rat) (pPB-C-His)
PV293450 500 ng
EUR 603
PEX14 Protein Vector (Rat) (pPB-N-His)
PV293451 500 ng
EUR 603
PEX14 Protein Vector (Rat) (pPM-C-HA)
PV293452 500 ng
EUR 603
PEX14 Protein Vector (Rat) (pPM-C-His)
PV293453 500 ng
EUR 603
Pex14 3'UTR GFP Stable Cell Line
TU166210 1.0 ml Ask for price
PEX14 3'UTR Luciferase Stable Cell Line
TU017755 1.0 ml
EUR 2333
Pex14 3'UTR Luciferase Stable Cell Line
TU116210 1.0 ml Ask for price
PEX14 3'UTR GFP Stable Cell Line
TU067755 1.0 ml
EUR 2333
Pex14 3'UTR GFP Stable Cell Line
TU266095 1.0 ml Ask for price
Pex14 3'UTR Luciferase Stable Cell Line
TU216095 1.0 ml Ask for price
Human Peroxisomal Biogenesis Factor 14 (PEX14) ELISA Kit
abx382160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
PEX14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV693781 1.0 ug DNA
EUR 682
PEX14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV693785 1.0 ug DNA
EUR 682
PEX14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV693786 1.0 ug DNA
EUR 682
Recombinant Pichia pastoris PEX14 Protein (aa 1-425)
VAng-Cr6650-1mgEcoli 1 mg (E. coli)
EUR 4903
Description: Pichia pastoris Peroxisomal membrane protein PEX14 (PEX14), recombinant protein.
Recombinant Pichia pastoris PEX14 Protein (aa 1-425)
VAng-Cr6650-500gEcoli 500 µg (E. coli)
EUR 3459
Description: Pichia pastoris Peroxisomal membrane protein PEX14 (PEX14), recombinant protein.
Recombinant Pichia pastoris PEX14 Protein (aa 1-425)
VAng-Cr6650-50gEcoli 50 µg (E. coli)
EUR 2360
Description: Pichia pastoris Peroxisomal membrane protein PEX14 (PEX14), recombinant protein.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PEX14 Rabbit Polyclonal Antibody