USF1 Rabbit Polyclonal Antibody

USF1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

USF1 Polyclonal Antibody

ABP60862-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of USF1 from Human, Mouse. This USF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170

USF1 Polyclonal Antibody

ABP60862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of USF1 from Human, Mouse. This USF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170

USF1 Polyclonal Antibody

ES8986-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against USF1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

USF1 Polyclonal Antibody

ES8986-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against USF1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

USF1 Rabbit pAb

A13560-100ul 100 ul
EUR 308

USF1 Rabbit pAb

A13560-200ul 200 ul
EUR 459

USF1 Rabbit pAb

A13560-20ul 20 ul
EUR 183

USF1 Rabbit pAb

A13560-50ul 50 ul
EUR 223

USF1 Antibody

32414-100ul 100ul
EUR 252

USF1 Antibody

42816-100ul 100ul
EUR 252

USF1 Antibody

1-CSB-PA938350
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USF1 Antibody

1-CSB-PA980290
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USF1 Antibody

DF6592 200ul
EUR 304
Description: USF1 Antibody detects endogenous levels of total USF1.

USF1 Antibody

1-CSB-PA025681HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

USF1 Antibody

CSB-PA025681KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

USF1 Antibody

CSB-PA025681KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

USF1 Antibody

ABD6592 100 ug
EUR 438

USF1 Polyclonal Antibody, Biotin Conjugated

A54721 100 µg
EUR 570.55
Description: reagents widely cited

USF1 Polyclonal Antibody, FITC Conjugated

A54722 100 µg
EUR 570.55
Description: Ask the seller for details

USF1 Polyclonal Antibody, HRP Conjugated

A54723 100 µg
EUR 570.55
Description: The best epigenetics products

USF1 (Phospho-Thr153) Polyclonal Conjugated Antibody

C12651 100ul
EUR 397

USF1 (pT153) Antibody

abx219267-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

USF1 Conjugated Antibody

C32414 100ul
EUR 397

anti- USF1 antibody

FNab09297 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: upstream transcription factor 1
  • Uniprot ID: P22415
  • Gene ID: 7391
  • Research Area: Metabolism
Description: Antibody raised against USF1

Anti-USF1 antibody

PAab09297 100 ug
EUR 412

Anti-USF1 antibody

STJ26051 100 µl
EUR 277
Description: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21.

Anti-USF1 antibody

STJ115521 100 µl
EUR 277
Description: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21.

Anti-USF1 antibody

STJ190144 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to USF1

USF1 siRNA

20-abx939129
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

USF1 siRNA

20-abx939130
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-USF1

YF-PA15249 100 ug
EUR 403
Description: Rabbit polyclonal to USF1

anti-USF1

YF-PA24948 50 ul
EUR 334
Description: Mouse polyclonal to USF1

anti-USF1

YF-PA27396 50 ug
EUR 363
Description: Mouse polyclonal to USF1

USF1 (Phospho-Thr153) Antibody

12651-100ul 100ul
EUR 252

USF1 (Phospho-Thr153) Antibody

12651-50ul 50ul
EUR 187

USF1 Antibody, HRP conjugated

1-CSB-PA025681HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USF1 Antibody, FITC conjugated

1-CSB-PA025681HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USF1 Antibody, Biotin conjugated

1-CSB-PA025681HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-USF1 (Thr153) Antibody

AF8331 200ul
EUR 376
Description: USF1 (Phospho-Thr153) Antibody detects endogenous levels of USF1 only when phosphorylated at Thr153.

USF1 (Phospho- Thr153) Antibody

ABF8331 100 ug
EUR 438

Rabbit Anti-Human upstream transcription factor 1 (USF1) (USF1- acetyl) IgG (aff pure)

AB-23272-A 100ug
EUR 482

USF1 Blocking Peptide

DF6592-BP 1mg
EUR 195

USF1 cloning plasmid

CSB-CL025681HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atgaaggggcagcagaaaacagctgaaacggaagaggggacagtgcagattcaggaaggtgcagtggctactggggaagacccaaccagtgtggctattgccagcatccagtcagctgccaccttccctgaccccaacgtcaagtacgtcttccgaactgagaatgggggccaggt
  • Show more
Description: A cloning plasmid for the USF1 gene.

pcDNA3.1-USF1 Plasmid

PVTB00093-2a 2 ug
EUR 356

pOTB7-USF1 Plasmid

PVTB00093S 2 ug
EUR 356

Anti-USF1 (3F6)

YF-MA16035 100 ug
EUR 363
Description: Mouse monoclonal to USF1

Anti-USF1 (2A7)

YF-MA16036 100 ug
EUR 363
Description: Mouse monoclonal to USF1

Rabbit Upstream stimulatory factor 1, USF1 ELISA KIT

ELI-16725Ra 96 Tests
EUR 928

Human upstream transcription factor 1 (USF1) control (USF1- acetyl) peptide

AB-23272-P 100ug
EUR 164

Monoclonal USF1 Antibody (Center), Clone: 1264CT170.274.14

APR10696G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USF1 (Center). The antibodies are raised in Mouse and are from clone 1264CT170.274.14. This antibody is applicable in WB, E

Upstream Stimulatory Factor 1 (USF1) Antibody

abx026074-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

abx026074-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Upstream stimulatory factor 1 (USF1) Antibody

20-abx212705
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Upstream stimulatory factor 1 (USF1) Antibody

20-abx212706
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

20-abx110338
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

abx117152-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

abx037743-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

20-abx142299
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

abx239297-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

20-abx001455
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

USF1 protein (His tag)

80R-3580 50 ug
EUR 424
Description: Purified recombinant USF1 protein (His tag)

USF1 ELISA KIT|Human

EF004107 96 Tests
EUR 689

Mouse USF1 shRNA Plasmid

20-abx973332
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human USF1 shRNA Plasmid

20-abx955057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

USF1 Recombinant Protein (Rat)

RP236000 100 ug Ask for price

USF1 Recombinant Protein (Human)

RP034054 100 ug Ask for price

USF1 Recombinant Protein (Mouse)

RP183287 100 ug Ask for price

Monoclonal USF1 Antibody (monoclonal) (M01), Clone: 3F6

APR10697G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human USF1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F6. This antibody is applicable in WB, E

Monoclonal USF1 Antibody (monoclonal) (M02), Clone: 2A7

APR10698G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human USF1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2A7. This antibody is applicable in WB, E

Phospho-USF1 (Thr153) Blocking Peptide

AF8331-BP 1mg
EUR 195

Usf1 ORF Vector (Mouse) (pORF)

ORF061097 1.0 ug DNA
EUR 506

Usf1 ORF Vector (Rat) (pORF)

ORF078668 1.0 ug DNA
EUR 506

USF1 ORF Vector (Human) (pORF)

ORF011352 1.0 ug DNA
EUR 95

pIRES2-EGFP-Flag-USF1 Plasmid

PVTB00093-2b 2 ug
EUR 356

USF1 ELISA Kit (Mouse) (OKEH03687)

OKEH03687 96 Wells
EUR 779
Description: Description of target: Transcription factor that binds to a symmetrical DNA sequence (E-boxes) (5'-CACGTG-3') that is found in a variety of viral and cellular promoters.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.19 ng/mL

Human Upstream stimulatory factor 1 (USF1)

1-CSB-EP025681HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Upstream stimulatory factor 1(USF1),partial expressed in E.coli

Upstream Stimulatory Factor 1 (USF1) Protein

20-abx262723
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Usf1 sgRNA CRISPR Lentivector set (Rat)

K7068101 3 x 1.0 ug
EUR 339

Usf1 sgRNA CRISPR Lentivector set (Mouse)

K4640001 3 x 1.0 ug
EUR 339

USF1 sgRNA CRISPR Lentivector set (Human)

K2594401 3 x 1.0 ug
EUR 339

Usf1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7068102 1.0 ug DNA
EUR 154

Usf1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7068103 1.0 ug DNA
EUR 154

Usf1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7068104 1.0 ug DNA
EUR 154

Usf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4640002 1.0 ug DNA
EUR 154

Usf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4640003 1.0 ug DNA
EUR 154

Usf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4640004 1.0 ug DNA
EUR 154

USF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2594402 1.0 ug DNA
EUR 154

USF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2594403 1.0 ug DNA
EUR 154

USF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2594404 1.0 ug DNA
EUR 154

USF1 Protein Vector (Mouse) (pPB-C-His)

PV244386 500 ng
EUR 603

USF1 Protein Vector (Mouse) (pPB-N-His)

PV244387 500 ng
EUR 603

USF1 Protein Vector (Mouse) (pPM-C-HA)

PV244388 500 ng
EUR 603

USF1 Protein Vector (Mouse) (pPM-C-His)

PV244389 500 ng
EUR 603

USF1 Protein Vector (Rat) (pPB-C-His)

PV314670 500 ng
EUR 603

USF1 Protein Vector (Rat) (pPB-N-His)

PV314671 500 ng
EUR 603

USF1 Protein Vector (Rat) (pPM-C-HA)

PV314672 500 ng
EUR 603

USF1 Protein Vector (Rat) (pPM-C-His)

PV314673 500 ng
EUR 603

USF1 Protein Vector (Human) (pPB-C-His)

PV045405 500 ng
EUR 329

USF1 Protein Vector (Human) (pPB-N-His)

PV045406 500 ng
EUR 329

USF1 Protein Vector (Human) (pPM-C-HA)

PV045407 500 ng
EUR 329

USF1 Protein Vector (Human) (pPM-C-His)

PV045408 500 ng
EUR 329

Usf1 3'UTR Luciferase Stable Cell Line

TU121634 1.0 ml Ask for price

USF1 3'UTR GFP Stable Cell Line

TU077899 1.0 ml
EUR 1521

Usf1 3'UTR GFP Stable Cell Line

TU171634 1.0 ml Ask for price

Usf1 3'UTR Luciferase Stable Cell Line

TU222909 1.0 ml Ask for price

USF1 3'UTR Luciferase Stable Cell Line

TU027899 1.0 ml
EUR 1521

Usf1 3'UTR GFP Stable Cell Line

TU272909 1.0 ml Ask for price

Mouse Usf1/ Upstream stimulatory factor 1 ELISA Kit

E1567Mo 1 Kit
EUR 632

Human USF1/ Upstream stimulatory factor 1 ELISA Kit

E2646Hu 1 Kit
EUR 605

Human Upstream stimulatory factor 1, USF1 ELISA KIT

ELI-17777h 96 Tests
EUR 824

Bovine Upstream stimulatory factor 1, USF1 ELISA KIT

ELI-22462b 96 Tests
EUR 928

Mouse Upstream stimulatory factor 1 (Usf1) ELISA Kit

abx555523-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Upstream stimulatory factor 1 (USF1) ELISA Kit

abx555550-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Upstream stimulatory factor 1 (USF1) ELISA Kit

abx555772-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Upstream stimulatory factor 1, Usf1 ELISA KIT

ELI-40428m 96 Tests
EUR 865

USF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV668323 1.0 ug DNA
EUR 514

USF1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV668327 1.0 ug DNA
EUR 514

USF1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV668328 1.0 ug DNA
EUR 514

USF1 Upstream Transcription Factor 1 Human Recombinant Protein

PROTP22415 Regular: 10ug
EUR 317
Description: USF1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 333 amino acids (1-310 a.a) and having a molecular mass of 35.9kDa.;USF1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

USF1 Rabbit Polyclonal Antibody