CD52 Rabbit Polyclonal Antibody

CD52 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CD52 Polyclonal Antibody
ABP58069-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD52 protein at amino acid sequence of 20-50
  • Applications tips:
Description: A polyclonal antibody for detection of CD52 from Human. This CD52 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD52 protein at amino acid sequence of 20-50
CD52 Polyclonal Antibody
ABP58069-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD52 protein at amino acid sequence of 20-50
  • Applications tips:
Description: A polyclonal antibody for detection of CD52 from Human. This CD52 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD52 protein at amino acid sequence of 20-50
CD52 Polyclonal Antibody
ES8787-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD52 from Human. This antibody is tested and validated for IHC, WB, ELISA
CD52 Polyclonal Antibody
ES8787-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD52 from Human. This antibody is tested and validated for IHC, WB, ELISA
CD52 Rabbit pAb
A16815-100ul 100 ul
EUR 308
CD52 Rabbit pAb
A16815-200ul 200 ul
EUR 459
CD52 Rabbit pAb
A16815-20ul 20 ul
EUR 183
CD52 Rabbit pAb
A16815-50ul 50 ul
EUR 223
CD52 Antibody
45501-100ul 100ul
EUR 252
CD52 Antibody
45501-50ul 50ul
EUR 187
CD52 Antibody
DF8797 200ul
EUR 304
Description: CD52 Antibody detects endogenous levels of total CD52.
CD52 Antibody
1-CSB-PA338154
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CD52. Recognizes CD52 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000
CD52 antibody
70R-51264 100 ul
EUR 244
Description: Purified Polyclonal CD52 antibody
CD52 Antibody
ABD8797 100 ug
EUR 438
CD52
52A-100T 100 test
EUR 349
CD52
52B-01MG 100 test
EUR 284
CD52
52CFB-100T 100 test
EUR 388
CD52
52F-100T 100 test
EUR 297
CD52
52PE-100T 100 test
EUR 349
CD52
52PP-100T 100 test
EUR 349
CD52
52PU-01MG 0,1 mg
EUR 219
Anti-CD52 antibody
STJ119203 100 µl
EUR 277
Anti-CD52 antibody
STJ98992 200 µl
EUR 197
Description: Rabbit polyclonal to CD52.
Cd52/ Rat Cd52 ELISA Kit
ELI-03728r 96 Tests
EUR 886
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCR2276-250 250uL
EUR 394
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), RPE conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNUB2276-100 100uL
EUR 264
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Concentration: 0.2mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNUB2276-50 50uL
EUR 405
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), 1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNUB2276-500 500uL
EUR 513
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Concentration: 0.2mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC552276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF555 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC552276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF555 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC432276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF543 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC432276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF543 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC472276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF647 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC472276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF647 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC042276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF405S conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC042276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF405S conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC052276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF405M conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC052276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF405M conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC402276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF640R conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC402276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF640R conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC702276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF770 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC702276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF770 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC802276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF680 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC802276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF680 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCH2276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCH2276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCP2276-250 250uL
EUR 394
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), PerCP conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC942276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF594 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC942276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF594 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCA2276-250 250uL
EUR 394
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), APC conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCB2276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Biotin conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCB2276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Biotin conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC882276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF488A conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC882276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF488A conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC682276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF568 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC682276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF568 conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCAP2276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNCAP2276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC812276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF680R conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC812276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF680R conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC612276-100 100uL
EUR 233
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF660R conjugate, Concentration: 0.1mg/mL
CD52 (Epididymis-Specific Protein 5) (CD52/2276R) Antibody
BNC612276-500 500uL
EUR 545
Description: Primary antibody against CD52 (Epididymis-Specific Protein 5) (CD52/2276R), CF660R conjugate, Concentration: 0.1mg/mL
CD52 siRNA
20-abx900918
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD52 siRNA
20-abx911043
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD52 siRNA
20-abx911044
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-CD52
PVT18723 2 ug
EUR 231
CD52 recombinant monoclonal antibody
A5597 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human CD52 for WB ,ELISA
Anti-CD52 Monoclonal Antibody
M03484 100ug
EUR 397
Description: Rabbit Monoclonal CD52 Antibody. Validated in IP, WB and tested in Mouse.
CD52 Blocking Peptide
DF8797-BP 1mg
EUR 195
CD52 Blocking Peptide
20-abx064139
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
CD52 cloning plasmid
CSB-CL004943HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 186
  • Sequence: atgaagcgcttcctcttcctcctactcaccatcagcctcctggttatggtacagatacaaactggactctcaggacaaaacgacaccagccaaaccagcagcccctcagcatccagcagcatgagcggaggcattttccttttcttcgtggccaatgccataatccacctcttctg
  • Show more
Description: A cloning plasmid for the CD52 gene.
Cluster of Differentiation 52 (CD52) Antibody
20-abx007880
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Cluster Of Differentiation 52 (CD52) Antibody
20-abx175908
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cluster of Differentiation 52 (CD52) Antibody
abx200358-100ug 100 ug
EUR 328
  • Shipped within 2-3 weeks.
Cluster of Differentiation 52 (CD52) Antibody
20-abx149093
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cluster of Differentiation 52 (CD52) Antibody
abx139353-01mg 0.1 mg
EUR 384
  • Shipped within 5-12 working days.
Cluster Of Differentiation 52 (CD52) Antibody
20-abx171795
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Rat Anti Human Cd52 Monoclonal Antibody
CABT-46439RH 20 µg
EUR 429
Rat Anti Human Cd52 Monoclonal Antibody
CABT-46440RH 0.2 mg
EUR 892
Rat Anti Human Cd52 Monoclonal Antibody
CABT-46450RH 0.1 ml
EUR 751
Cluster Of Differentiation 52 (CD52) Antibody
20-abx323206
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Hu CD52 Purified
11-368-C025 0.025 mg
EUR 108
Anti-Hu CD52 Purified
11-368-C100 0.1 mg
EUR 177
Anti-Hu CD52 APC
1A-368-T025 25 tests
EUR 140
Anti-Hu CD52 APC
1A-368-T100 100 tests
EUR 240
Anti-Hu CD52 FITC
1F-368-T025 25 tests
EUR 122
Anti-Hu CD52 FITC
1F-368-T100 100 tests
EUR 204
Anti-Hu CD52 PE
1P-368-T025 25 tests
EUR 140
Anti-Hu CD52 PE
1P-368-T100 100 tests
EUR 240
Human CD52 ELISA Kit
ELA-E1131h 96 Tests
EUR 824
CD52 (Human) ELISA Kit
E4551-100
EUR 805
Canine CD52 ELISA KIT
ELI-03730d 96 Tests
EUR 928
CD52 ELISA KIT|Human
EF003494 96 Tests
EUR 689
Mouse CD52 shRNA Plasmid
20-abx973518
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat CD52 shRNA Plasmid
20-abx987396
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CD52 shRNA Plasmid
20-abx950752
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CD52 Recombinant Protein (Human)
RP006382 100 ug Ask for price
CD52 Recombinant Protein (Rat)
RP193988 100 ug Ask for price
CD52 Recombinant Protein (Mouse)
RP122639 100 ug Ask for price
Anti-CD52 (Campath-1H), Human IgG1 Antibody
A1105-200
EUR 778
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx200359-100tests 100 tests
EUR 398
  • Shipped within 2-3 weeks.
Cluster of Differentiation 52 (CD52) Antibody (PE)
abx200360-100tests 100 tests
EUR 453
  • Shipped within 3-5 working days.
Cluster of Differentiation 52 (CD52) Antibody (APC)
abx200361-100tests 100 tests
EUR 453
  • Shipped within 3-5 working days.
Cluster of Differentiation 52 (CD52) Antibody (PerCP)
abx200362-100tests 100 tests
EUR 537
  • Shipped within 3-5 working days.
Cluster of Differentiation 52 (CD52) Antibody (Biotin)
abx200363-100ug 100 ug
EUR 384
  • Shipped within 2-3 weeks.
Cluster of Differentiation 52 (CD52) Antibody (PE)
abx139354-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
Cluster of Differentiation 52 (CD52) Antibody (APC)
abx139355-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx139356-100tests 100 tests
EUR 425
  • Shipped within 5-12 working days.
Rat Anti Human Cd52 Monoclonal Antibody,FITC
CABT-46437RH 0.1 mg
EUR 767
Rat Anti Human Cd52 Monoclonal Antibody,RPE
CABT-46441RH 100 TEST
EUR 985
Mouse Anti Human Cd52 Monoclonal Antibody,RPE
CABT-46449MH 100 TEST
EUR 741
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx413238-01mg 0.1 mg
EUR 801
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx413239-25ug 25 ug
EUR 300
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (RPE)
abx413240-100tests 100 tests
EUR 801
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (RPE)
abx413241-25tests025ml 25 tests (0.25 ml)
EUR 356
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx413810-01mg 0.1 mg
EUR 578
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx413811-10ug 10 ug
EUR 300
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (RPE)
abx413813-100tests 100 tests
EUR 592
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (RPE)
abx413814-25tests 25 tests
EUR 314
  • Shipped within 1 week.
Cluster of Differentiation 52 (CD52) Antibody (FITC)
abx415300-01mg 0.1 mg
EUR 648
  • Shipped within 1 week.
Human CAMPATH-1 antigen (CD52)
1-CSB-EP004943HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 5.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human CAMPATH-1 antigen (CD52) expressed in E.coli
Human CAMPATH-1 antigen (CD52)
1-CSB-YP004943HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 3.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human CAMPATH-1 antigen(CD52),partial expressed in Yeast
Cd52 ORF Vector (Rat) (pORF)
ORF064664 1.0 ug DNA
EUR 506
CD52 ORF Vector (Human) (pORF)
ORF002128 1.0 ug DNA
EUR 95
Cd52 ORF Vector (Mouse) (pORF)
ORF040881 1.0 ug DNA
EUR 506
Anti-Hu CD52 Pacific Blue
PB-368-T025 25 tests
EUR 154
Anti-Hu CD52 Pacific Blue
PB-368-T100 100 tests
EUR 269
CD52 ELISA Kit (Human) (OKAN06598)
OKAN06598 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL
CD52 ELISA Kit (Mouse) (OKCA02349)
OKCA02349 96 Wells
EUR 846
Description: Description of target: May play a role in carrying and orienting carbohydrate, as well as having a more specific role. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 5.86 pg/mL
CD52 ELISA Kit (Human) (OKCD07273)
OKCD07273 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.32ng/mL
CD52 ELISA Kit (Human) (OKEH04460)
OKEH04460 96 Wells
EUR 662
Description: Description of target: May play a role in carrying and orienting carbohydrate, as well as having a more specific role.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL
CD52 ELISA Kit (Mouse) (OKEH05667)
OKEH05667 96 Wells
EUR 662
Description: Description of target: May play a role in carrying and orienting carbohydrate, as well as having a more specific role. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
CD52 ELISA Kit (Rat) (OKEH06225)
OKEH06225 96 Wells
EUR 662
Description: Description of target: May play a role in carrying and orienting carbohydrate, as well as having a more specific role. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
CD52 ELISA Kit (Dog) (OKEH07724)
OKEH07724 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL
Cluster of Differentiation 52 (CD52) Antibody (CF-Blue)
abx200364-100tests 100 tests
EUR 481
  • Shipped within 2-3 weeks.
Mouse Monoclonal Anti-Human CD52, Unlabeled
CD52UL-100 100 ug
EUR 408
Anti-CD52 (Alemtuzumab)-SMCC-DM1 ADC
ADC-W-938 1mg Ask for price
Description: This ADC product is comprised of an anti-CD52 monoclonal antibody conjugated via a SMCC linker to DM1
Anti-CD52 (Alemtuzumab)-SPDB-DM4 ADC
ADC-W-939 1mg Ask for price
Description: This ADC product is comprised of an anti-CD52 monoclonal antibody conjugated via a SPDB linker to DM4
Anti-CD52 (Alemtuzumab)-MC-MMAF ADC
ADC-W-940 1mg Ask for price
Description: This ADC product is comprised of an anti-CD52 monoclonal antibody conjugated via a MC linker to MMAF
CD52 sgRNA CRISPR Lentivector set (Human)
K0403001 3 x 1.0 ug
EUR 339
Cd52 sgRNA CRISPR Lentivector set (Rat)
K6953901 3 x 1.0 ug
EUR 339
Cd52 sgRNA CRISPR Lentivector set (Mouse)
K3366401 3 x 1.0 ug
EUR 339
h CD52 (6His) inducible lentiviral particles
LVP1097 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CD52 (6His) (human CD52 molecule ), [alternative names: CDW52; EDDM5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001803.2. It contains a RFP-Blasticidin dual selection marker.
Recombinant CD52 Protein (Met1-Ser36) [His]
VAng-Cr3757-100g 100 µg
EUR 1580
Description: Recombinant CD52 Protein (Met1-Ser36) fused with a His tag at C-terminus was expressed in Mammalian cells, with a molecular weight of 35-45 kDa. (Uniprot ID: P31358)
Rat Cd52/ CAMPATH-1 antigen ELISA Kit
E0181Ra 1 Kit
EUR 571
Human CD52/ CAMPATH-1 antigen ELISA Kit
E0429Hu 1 Kit
EUR 571
Human CAMPATH-1 Antigen (CD52) ELISA Kit
20-abx156727
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human CAMPATH-1 Antigen (CD52) ELISA Kit
abx250549-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human CD52(CAMPATH-1 antigen) ELISA Kit
EH1286 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P31358
  • Alias: CD52(CAMPATH-1 antigen)/CDW52/HE5/Human epididymis-specific protein 5/Epididymal secretory protein E5/Cambridge pathology 1 antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human CAMPATH- 1 antigen, CD52 ELISA KIT
ELI-03729h 96 Tests
EUR 824
Mouse CAMPATH- 1 antigen, Cd52 ELISA KIT
ELI-03731m 96 Tests
EUR 865
Mouse Monoclonal Anti-Human CD52-FITC conjugate
CD52F-100 100 Tests
EUR 469
Mouse Monoclonal Anti-Human CD52-PE conjugate
CD52P-100 100 Tests
EUR 469
Human CAMPATH-1 antigen(CD52) ELISA kit
CSB-EL004943HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CAMPATH-1 antigen (CD52) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human CAMPATH-1 antigen(CD52) ELISA kit
1-CSB-EL004943HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CAMPATH-1 antigen(CD52) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse CAMPATH-1 antigen(CD52) ELISA kit
CSB-EL004943MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse CAMPATH-1 antigen (CD52) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse CAMPATH-1 antigen(CD52) ELISA kit
1-CSB-EL004943MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse CAMPATH-1 antigen(CD52) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Cluster Of Differentiation 52 (CD52) Protein
20-abx652965
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Dog CAMPATH-1 Antigen (CD52) ELISA Kit
abx515371-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse CAMPATH-1 Antigen (CD52) ELISA Kit
abx515373-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat CAMPATH-1 Antigen (CD52) ELISA Kit
abx515374-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
CD52 sgRNA CRISPR Lentivector (Human) (Target 1)
K0403002 1.0 ug DNA
EUR 154
CD52 sgRNA CRISPR Lentivector (Human) (Target 2)
K0403003 1.0 ug DNA
EUR 154
CD52 sgRNA CRISPR Lentivector (Human) (Target 3)
K0403004 1.0 ug DNA
EUR 154
Cd52 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6953902 1.0 ug DNA
EUR 154
Cd52 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6953903 1.0 ug DNA
EUR 154
Cd52 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6953904 1.0 ug DNA
EUR 154
Cd52 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3366402 1.0 ug DNA
EUR 154
Cd52 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3366403 1.0 ug DNA
EUR 154
Cd52 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3366404 1.0 ug DNA
EUR 154
CD52 Protein Vector (Mouse) (pPB-C-His)
PV163522 500 ng
EUR 603
CD52 Protein Vector (Mouse) (pPB-N-His)
PV163523 500 ng
EUR 603
CD52 Protein Vector (Mouse) (pPM-C-HA)
PV163524 500 ng
EUR 603
CD52 Protein Vector (Mouse) (pPM-C-His)
PV163525 500 ng
EUR 603
CD52 Protein Vector (Rat) (pPB-C-His)
PV258654 500 ng
EUR 603
CD52 Protein Vector (Rat) (pPB-N-His)
PV258655 500 ng
EUR 603
CD52 Protein Vector (Rat) (pPM-C-HA)
PV258656 500 ng
EUR 603
CD52 Protein Vector (Rat) (pPM-C-His)
PV258657 500 ng
EUR 603
CD52 Protein Vector (Human) (pPB-C-His)
PV008509 500 ng
EUR 329
CD52 Protein Vector (Human) (pPB-N-His)
PV008510 500 ng
EUR 329
CD52 Protein Vector (Human) (pPM-C-HA)
PV008511 500 ng
EUR 329
CD52 Protein Vector (Human) (pPM-C-His)
PV008512 500 ng
EUR 329
Cd52 3'UTR GFP Stable Cell Line
TU153513 1.0 ml Ask for price
Cd52 3'UTR Luciferase Stable Cell Line
TU103513 1.0 ml Ask for price
Cd52 3'UTR Luciferase Stable Cell Line
TU201987 1.0 ml Ask for price
Cd52 3'UTR GFP Stable Cell Line
TU251987 1.0 ml Ask for price
CD52 3'UTR GFP Stable Cell Line
TU053898 1.0 ml
EUR 1394
CD52 3'UTR Luciferase Stable Cell Line
TU003898 1.0 ml
EUR 1394
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

CD52 Rabbit Polyclonal Antibody