EFNB2 Rabbit Polyclonal Antibody

EFNB2 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

EFNB2 Polyclonal Antibody

ES9042-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EFNB2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EFNB2 Polyclonal Antibody

ES9042-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EFNB2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Ephrin B2 (EFNB2) ELISA Kit

DLR-EFNB2-Hu-48T 48T
EUR 517
  • Should the Human Ephrin B2 (EFNB2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ephrin B2 (EFNB2) ELISA Kit

DLR-EFNB2-Hu-96T 96T
EUR 673
  • Should the Human Ephrin B2 (EFNB2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Ephrin B2 (EFNB2) ELISA Kit

DLR-EFNB2-Mu-48T 48T
EUR 527
  • Should the Mouse Ephrin B2 (EFNB2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ephrin B2 (EFNB2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Ephrin B2 (EFNB2) ELISA Kit

DLR-EFNB2-Mu-96T 96T
EUR 688
  • Should the Mouse Ephrin B2 (EFNB2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ephrin B2 (EFNB2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Ephrin B2 (EFNB2) ELISA Kit

RDR-EFNB2-Hu-48Tests 48 Tests
EUR 544

Human Ephrin B2 (EFNB2) ELISA Kit

RDR-EFNB2-Hu-96Tests 96 Tests
EUR 756

Mouse Ephrin B2 (EFNB2) ELISA Kit

RDR-EFNB2-Mu-48Tests 48 Tests
EUR 557

Mouse Ephrin B2 (EFNB2) ELISA Kit

RDR-EFNB2-Mu-96Tests 96 Tests
EUR 774

Human Ephrin B2 (EFNB2) ELISA Kit

RD-EFNB2-Hu-48Tests 48 Tests
EUR 521

Human Ephrin B2 (EFNB2) ELISA Kit

RD-EFNB2-Hu-96Tests 96 Tests
EUR 723

Mouse Ephrin B2 (EFNB2) ELISA Kit

RD-EFNB2-Mu-48Tests 48 Tests
EUR 533

Mouse Ephrin B2 (EFNB2) ELISA Kit

RD-EFNB2-Mu-96Tests 96 Tests
EUR 740

EFNB2 Rabbit pAb

A12961-100ul 100 ul
EUR 308

EFNB2 Rabbit pAb

A12961-200ul 200 ul
EUR 459

EFNB2 Rabbit pAb

A12961-20ul 20 ul
EUR 183

EFNB2 Rabbit pAb

A12961-50ul 50 ul
EUR 223

EFNB2 Rabbit pAb

A5669-100ul 100 ul
EUR 308

EFNB2 Rabbit pAb

A5669-200ul 200 ul
EUR 459

EFNB2 Rabbit pAb

A5669-20ul 20 ul
EUR 183

EFNB2 Rabbit pAb

A5669-50ul 50 ul
EUR 223

Polyclonal EFNB2 Antibody (Center)

APR03592G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EFNB2 (Center). This antibody is tested and proven to work in the following applications:

Rabbit Anti-Human EFNB2 Polyclonal Antibody, Phospho-Tyr316

CPB-1268RH 100 ul
EUR 559

Rabbit Anti-Human EFNB2 Polyclonal Antibody, Phospho-Tyr330

CPB-1269RH 100 ul
EUR 559

EFNB2 Antibody

32963-100ul 100ul
EUR 252

EFNB2 Antibody

DF7450 200ul
EUR 304
Description: EFNB2 Antibody detects endogenous levels of total EFNB2.

EFNB2 Antibody

1-CSB-PA035369
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EFNB2. Recognizes EFNB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

EFNB2 antibody

70R-36125 100 ug
EUR 349
Description: Rabbit polyclonal EFNB2 antibody

EFNB2 Antibody

1-CSB-PA007466ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EFNB2. Recognizes EFNB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EFNB2 Antibody

1-CSB-PA007466ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EFNB2. Recognizes EFNB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

EFNB2 Antibody

ABD7450 100 ug
EUR 438

Polyclonal EFNB2 Antibody (internal region)

APG00690G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EFNB2 (internal region). This antibody is tested and proven to work in the following applications:

Rabbit Anti-Human EFNB2 (aa 314-318) Polyclonal Antibody

CPB-1086RH 100 ul
EUR 460

Rabbit Anti-Human EFNB2 (aa 328-332) Polyclonal Antibody

CPB-1087RH 100 ul
EUR 460

Ephrin B2 (EFNB2) Polyclonal Antibody (Human)

4-PAE112Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2)

Phospho-EFNB2-Y316 Rabbit pAb

AP0338-100ul 100 ul
EUR 384

Phospho-EFNB2-Y316 Rabbit pAb

AP0338-200ul 200 ul
EUR 554

Phospho-EFNB2-Y316 Rabbit pAb

AP0338-20ul 20 ul Ask for price

Phospho-EFNB2-Y316 Rabbit pAb

AP0338-50ul 50 ul
EUR 265

Phospho-EFNB2-Y330 Rabbit pAb

AP0339-100ul 100 ul
EUR 384

Phospho-EFNB2-Y330 Rabbit pAb

AP0339-200ul 200 ul
EUR 554

Phospho-EFNB2-Y330 Rabbit pAb

AP0339-20ul 20 ul Ask for price

Phospho-EFNB2-Y330 Rabbit pAb

AP0339-50ul 50 ul
EUR 265

EFNB1/EFNB2 Antibody

1-CSB-PA002377
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EFNB1/EFNB2. Recognizes EFNB1/EFNB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

EFNB2 Conjugated Antibody

C32963 100ul
EUR 397

EFNB1 / EFNB2 Antibody

20-abx328721
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EFNB2 (pY316) Antibody

20-abx000386
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EFNB2 (pY330) Antibody

20-abx000387
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-EFNB2 antibody

STJ27636 100 µl
EUR 277
Description: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors.

Anti-EFNB2 antibody

STJ114827 100 µl
EUR 277
Description: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors.

Anti-EFNB2 antibody

STJ72325 100 µg
EUR 359

Anti-EFNB2 antibody

STJ190200 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EFNB2

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), APC

4-PAE112Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with APC.

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), Biotinylated

4-PAE112Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with Biotin.

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), Cy3

4-PAE112Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with Cy3.

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), FITC

4-PAE112Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with FITC.

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), HRP

4-PAE112Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with HRP.

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), PE

4-PAE112Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with PE.

EFNB2 siRNA

20-abx915047
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EFNB2 siRNA

20-abx915048
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EFNB2 (Ab-330) Antibody

CSB-PA077593-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EFNB2 (Ab-330). Recognizes EFNB2 (Ab-330) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

EFNB2 (Ab-330) Antibody

CSB-PA077593-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EFNB2 (Ab-330). Recognizes EFNB2 (Ab-330) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

EFNB2 (Ab-316) Antibody

CSB-PA587215-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EFNB2 (Ab-316). Recognizes EFNB2 (Ab-316) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EFNB2 (Ab-316) Antibody

CSB-PA587215-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against EFNB2 (Ab-316). Recognizes EFNB2 (Ab-316) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EFNB2 (Tyr316) Antibody

CSB-PA166153-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EFNB2 (Tyr316). Recognizes Phospho-EFNB2 (Tyr316) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EFNB2 (Tyr316) Antibody

CSB-PA166153-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EFNB2 (Tyr316). Recognizes Phospho-EFNB2 (Tyr316) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EFNB2 (Tyr330) Antibody

CSB-PA216331-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EFNB2 (Tyr330). Recognizes Phospho-EFNB2 (Tyr330) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EFNB2 (Tyr330) Antibody

CSB-PA216331-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EFNB2 (Tyr330). Recognizes Phospho-EFNB2 (Tyr330) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Ephrin B2 (EFNB2) Antibody

abx026365-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

abx026365-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

20-abx004336
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

20-abx176294
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ephrin B2 (EFNB2) Antibody

20-abx176295
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ephrin B2 (EFNB2) Antibody

20-abx212395
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

20-abx128034
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ephrin B2 (EFNB2) Antibody

abx037050-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

20-abx172265
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ephrin B2 (EFNB2) Antibody

20-abx320109
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

abx331407-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

abx331431-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

EFNB1 / EFNB2 (pY329) Antibody

20-abx326410
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EFNB1 / EFNB2 (pY330) Antibody

20-abx327734
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

20-abx322189
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Antibody

abx431224-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ephrin B2 (EFNB2) Antibody

20-abx225154
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ephrin B2 (EFNB2) Polyclonal Antibody (Human), APC-Cy7

4-PAE112Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EFNB2 (Phe42~Val333)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ephrin B2 (EFNB2). This antibody is labeled with APC-Cy7.

EFNB2 Blocking Peptide

DF7450-BP 1mg
EUR 195

EFNB2 cloning plasmid

CSB-CL007466HU-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atggctgtgagaagggactccgtgtggaagtactgctggggtgttttgatggttttatgcagaactgcgatttccaaatcgatagttttagagcctatctattggaattcctcgaactccaaatttctacctggacaaggactggtactatacccacagataggagacaaattgg
  • Show more
Description: A cloning plasmid for the EFNB2 gene.

pECMV-EFNB2-3

PVT15976 2 ug
EUR 325

Phospho-EFNB1/EFNB2 (Y330) Antibody

1-CSB-PA000635
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EFNB1/EFNB2 (Y330). Recognizes Phospho-EFNB1/EFNB2 (Y330) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

Phospho-EFNB1/EFNB2 (Y329) Antibody

1-CSB-PA007920
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EFNB1/EFNB2 (Y329). Recognizes Phospho-EFNB1/EFNB2 (Y329) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

EFNB1 / EFNB2 / EFNB3 (pY324) Antibody

20-abx328480
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EFNB1 / EFNB2 / EFNB3 (pY324) Antibody

abx333310-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Anti-Phospho-EFNB2-(Y316) antibody

STJ22093 100 µl
EUR 393
Description: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors.

Anti-Phospho-EFNB2-(Y330) antibody

STJ22094 100 µl
EUR 393
Description: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors.

Phospho-EFNB1/EFNB2/EFNB3 (Tyr324) Antibody

CSB-PA142593-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-EFNB1/EFNB2/EFNB3 (Tyr324). Recognizes Phospho-EFNB1/EFNB2/EFNB3 (Tyr324) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-EFNB1/EFNB2/EFNB3 (Tyr324) Antibody

CSB-PA142593-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-EFNB1/EFNB2/EFNB3 (Tyr324). Recognizes Phospho-EFNB1/EFNB2/EFNB3 (Tyr324) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-EFNB1/EFNB2/EFNB3 (Y324) Antibody

1-CSB-PA007934
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EFNB1/EFNB2/EFNB3 (Y324). Recognizes Phospho-EFNB1/EFNB2/EFNB3 (Y324) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

EFNB2 protein (His tag)

80R-1976 100 ug
EUR 322
Description: Recombinant human EFNB2 protein (His tag)

Mouse EFNB2 shRNA Plasmid

20-abx970123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EFNB2 shRNA Plasmid

20-abx951345
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Ephrin B2 (EFNB2)

4-RPE112Hu01
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52799
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.3kDa
  • Isoelectric Point: 7.9
Description: Recombinant Human Ephrin B2 expressed in: E.coli

EFNB2 Recombinant Protein (Human)

RP010273 100 ug Ask for price

EFNB2 Recombinant Protein (Rat)

RP199175 100 ug Ask for price

EFNB2 Recombinant Protein (Mouse)

RP131021 100 ug Ask for price

Ephrin B2 Phospho-Tyr316 (EFNB2 pY316) Antibody

abx333046-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Ephrin B2 Phospho-Tyr330 (EFNB2 pY330) Antibody

abx333047-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Human Ephrin B2 (EFNB2) Protein

20-abx166409
  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ephrin B2 (EFNB2) Protein

20-abx653291
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Ephrin B2 (EFNB2) Protein

20-abx653292
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Ephrin B2 (EFNB2) Protein

20-abx653293
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Efnb2 ORF Vector (Rat) (pORF)

ORF066393 1.0 ug DNA
EUR 506

h EFNB2 inducible lentiviral particles

LVP795 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h EFNB2 (ephrin-B2), [alternative names: EPLG5; Htk-L; HTKL; LERK5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_004093.3. It also contains a RFP-Blasticidin dual selection marker.

EFNB2 ORF Vector (Human) (pORF)

ORF003425 1.0 ug DNA
EUR 95

Efnb2 ORF Vector (Mouse) (pORF)

ORF043675 1.0 ug DNA
EUR 506

EFNB2 ELISA Kit (Human) (OKAN06142)

OKAN06142 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

EFNB2 ELISA Kit (Human) (OKCD00417)

OKCD00417 96 Wells
EUR 831
Description: Description of target: Cell surface transmembrane ligand for Eph receptors, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development. Binds promiscuously Eph receptors residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Binds to receptor tyrosine kinase including EPHA4, EPHA3 and EPHB4. Together with EPHB4 plays a central role in heart morphogenesis and angiogenesis through regulation of cell adhesion and cell migration. EPHB4-mediated forward signaling controls cellular repulsion and segregation from EFNB2-expressing cells. May play a role in constraining the orientation of longitudinally projecting axons.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"Forward EphB4 signaling in endothelial cells controls cellular repulsion and segregation from ephrinB2 positive cells."_x005F_x005F_x000D_Fueller T., Korff T., Kilian A., Dandekar G., Augustin H.G._x005F_x005F_x000D_J. Cell Sci. 116:2461-2470(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN ANGIOGENESIS. (Microbial infection) Acts as a receptor for Hendra virus and Nipah virus.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"EphrinB2 is the entry receptor for Nipah virus, an emergent deadly paramyxovirus."_x005F_x005F_x000D_Negrete O.A., Levroney E.L., Aguilar H.C., Bertolotti-Ciarlet A., Nazarian R., Tajyar S., Lee B._x005F_x005F_x000D_Nature 436:401-405(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH NIPAH VIRUS GLYCOPROTEIN.Ref.8"Ephrin-B2 ligand is a functional receptor for Hendra virus and Nipah virus."_x005F_x005F_x000D_Bonaparte M.I., Dimitrov A.S., Bossart K.N., Crameri G., Mungall B.A., Bishop K.A., Choudhry V., Dimitrov D.S., Wang L.F., Eaton B.T., Broder C.C._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 102:10652-10657(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH HENDRA VIRUS GLYCOPROTEIN.Ref.9"Two key residues in ephrinB3 are critical for its use as an alternative receptor for Nipah virus."_x005F_x005F_x000D_Negrete O.A., Wolf M.C., Aguilar H.C., Enterlein S., Wang W., Muehlberger E., Su S.V., Bertolotti-Ciarlet A., Flick R., Lee B._x005F_x005F_x000D_PLoS Pathog. 2:78-86(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH NIPAH VIRUS GLYCOPROTEIN, MUTAGENESIS OF 121-LEU-TRP-122.Ref.10"Identification of Hendra virus G glycoprotein residues that are critical for receptor binding."_x005F_x005F_x000D_Bishop K.A., Stantchev T.S., Hickey A.C., Khetawat D., Bossart K.N., Krasnoperov V., Gill P., Feng Y.R., Wang L., Eaton B.T., Wang L.F., Broder C.C._x005F_x005F_x000D_J. Virol. 81:5893-5901(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH HENDRA VIRUS GLYCOPROTEIN. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL

EFNB2 ELISA Kit (Human) (OKDD00250)

OKDD00250 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.053 ng/mL

EFNB2 ELISA Kit (Mouse) (OKDD00673)

OKDD00673 96 Wells
EUR 988
Description: Description of target: Cell surface transmembrane ligand for eph receptors, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development. binds promiscuously eph receptors residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. the signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. binds to receptor tyrosine kinase including epha4, epha3 and ephb4. together with ephb4 plays a central role in heart morphogenesis and angiogenesis through regulation of cell adhesion and cell migration. ephb4-mediated forward signaling controls cellular repulsion and segregation from efnb2-expressing cells. may play a role in constraining the orientation of longitudinally projecting axons.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054 ng/mL

Mouse Ephrin B2 (EFNB2) ELISA Kit

20-abx153962
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ephrin B2 (EFNB2) ELISA Kit

20-abx151432
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ephrin- B2, EFNB2 ELISA KIT

ELI-26574h 96 Tests
EUR 824

Mouse Ephrin- B2, Efnb2 ELISA KIT

ELI-26575m 96 Tests
EUR 865

Human Ephrin-B2(EFNB2) ELISA kit

CSB-EL007466HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ephrin-B2 (EFNB2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ephrin-B2(EFNB2) ELISA kit

1-CSB-EL007466HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ephrin-B2(EFNB2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Ephrin B2 (EFNB2) ELISA Kit

abx570874-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Human Ephrin B2 (EFNB2) CLIA Kit

20-abx494502
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Ephrin B2 (EFNB2) CLIA Kit

20-abx494503
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

EFNB2 sgRNA CRISPR Lentivector set (Human)

K0661001 3 x 1.0 ug
EUR 339

Efnb2 sgRNA CRISPR Lentivector set (Rat)

K6667601 3 x 1.0 ug
EUR 339

Efnb2 sgRNA CRISPR Lentivector set (Mouse)

K4431501 3 x 1.0 ug
EUR 339

EFNB2 Ephrin- B2 Human Recombinant Protein

PROTP52799 Regular: 20ug
EUR 317
Description: EFNB2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (28-229 a.a.) and having a molecular mass of 24.9kDa.;EFNB2 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

EFNB2 Ephrin- B2 Mouse Recombinant Protein

PROTP52800 Regular: 5ug
EUR 317
Description: EFNB2 Mouse Recombinant produced in Sf9 Baculovirus cells is a single polypeptide chain containing 212 amino acids (29-232) and having a molecular mass of 23.4kDa.;(Molecular size on SDS-PAGE will appear at approximately 28-40KDa).;EFNB2 is fused to 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

Human Ephrin B2(EFNB2)ELISA Kit  

QY-E03396 96T
EUR 361

Human Ephrin B2 ELISA Kit (EFNB2)

RK01297 96 Tests
EUR 521

Human Ephrin B2 (EFNB2) ELISA Kit

SEE112Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ephrin B2 (EFNB2) ELISA Kit

SEE112Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ephrin B2 (EFNB2) ELISA Kit

SEE112Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ephrin B2 (EFNB2) ELISA Kit

SEE112Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ephrin B2 (EFNB2) ELISA Kit

4-SEE112Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ephrin B2 elisa. Alternative names of the recognized antigen: EPLG5
  • HTKL
  • Htk-L
  • LERK5
  • HTK Ligand
  • Ligand Of Eph-Related Kinase 5
  • Eph-Related Receptor Tyrosine Kinase Ligand 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Ephrin B2 (EFNB2) ELISA Kit

SEE112Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ephrin B2 (EFNB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Ephrin B2 (EFNB2) ELISA Kit

SEE112Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ephrin B2 (EFNB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Ephrin B2 (EFNB2) ELISA Kit

SEE112Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ephrin B2 (EFNB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Ephrin B2 (EFNB2) ELISA Kit

SEE112Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ephrin B2 (EFNB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Ephrin B2 (EFNB2) ELISA Kit

4-SEE112Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ephrin B2 elisa. Alternative names of the recognized antigen: EPLG5
  • HTKL
  • Htk-L
  • LERK5
  • HTK Ligand
  • Ligand Of Eph-Related Kinase 5
  • Eph-Related Receptor Tyrosine Kinase Ligand 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Ephrin B2 ELISA Kit (EFNB2)

RK02763 96 Tests
EUR 521

Recombinant Human Ephrin-B2/EFNB2 Protein

RP00091 10 μg
EUR 155

ELISA kit for Human EFNB2 (Ephrin B2)

ELK3353 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ephrin B2 (EFNB2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ephrin B2 (EFNB2
  • Show more
Description: A sandwich ELISA kit for detection of Ephrin B2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Recombinant Human Ephrin-B2/EFNB2 (C-6His)

C465-10ug 10ug
EUR 80
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Ephrin-B2/EFNB2 (C-6His)

C465-1mg 1mg
EUR 1166
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Ephrin-B2/EFNB2 (C-6His)

C465-500ug 500ug
EUR 831
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Ephrin-B2/EFNB2 (C-6His)

C465-50ug 50ug
EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

ELISA kit for Mouse EFNB2 (Ephrin B2)

ELK6196 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ephrin B2 (EFNB2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ephrin B2 (EFNB2
  • Show more
Description: A sandwich ELISA kit for detection of Ephrin B2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

EFNB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0661002 1.0 ug DNA
EUR 154

EFNB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0661003 1.0 ug DNA
EUR 154

EFNB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0661004 1.0 ug DNA
EUR 154

ELISA kit for Human Ephrin-B2 (EFNB2)

KTE62437-48T 48T
EUR 332
  • Ephrin-B2 is a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ephrin-B2 (EFNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ephrin-B2 (EFNB2)

KTE62437-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Ephrin-B2 is a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ephrin-B2 (EFNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ephrin-B2 (EFNB2)

KTE62437-96T 96T
EUR 539
  • Ephrin-B2 is a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ephrin-B2 (EFNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Efnb2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6667602 1.0 ug DNA
EUR 154

Efnb2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6667603 1.0 ug DNA
EUR 154

Efnb2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6667604 1.0 ug DNA
EUR 154

Efnb2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4431502 1.0 ug DNA
EUR 154

Efnb2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4431503 1.0 ug DNA
EUR 154

Efnb2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4431504 1.0 ug DNA
EUR 154

ELISA kit for Mouse Ephrin-B2 (EFNB2)

KTE71221-48T 48T
EUR 332
  • Ephrin-B2 is a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system a
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Ephrin-B2 (EFNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Ephrin-B2 (EFNB2)

KTE71221-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Ephrin-B2 is a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system a
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Ephrin-B2 (EFNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Ephrin-B2 (EFNB2)

KTE71221-96T 96T
EUR 539
  • Ephrin-B2 is a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system a
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Ephrin-B2 (EFNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

EFNB2 Protein Vector (Mouse) (pPB-C-His)

PV174698 500 ng
EUR 603

EFNB2 Protein Vector (Mouse) (pPB-N-His)

PV174699 500 ng
EUR 603

EFNB2 Protein Vector (Mouse) (pPM-C-HA)

PV174700 500 ng
EUR 603

EFNB2 Protein Vector (Mouse) (pPM-C-His)

PV174701 500 ng
EUR 603

EFNB2 Protein Vector (Rat) (pPB-C-His)

PV265570 500 ng
EUR 603

EFNB2 Protein Vector (Rat) (pPB-N-His)

PV265571 500 ng
EUR 603

EFNB2 Protein Vector (Rat) (pPM-C-HA)

PV265572 500 ng
EUR 603

EFNB2 Protein Vector (Rat) (pPM-C-His)

PV265573 500 ng
EUR 603

EFNB2 Protein Vector (Human) (pPB-C-His)

PV013697 500 ng
EUR 329

EFNB2 Protein Vector (Human) (pPB-N-His)

PV013698 500 ng
EUR 329

EFNB2 Protein Vector (Human) (pPM-C-HA)

PV013699 500 ng
EUR 329

EFNB2 Protein Vector (Human) (pPM-C-His)

PV013700 500 ng
EUR 329

Recombinant Human EFNB2 Protein, His, E.coli-1mg

QP11754-1mg 1mg
EUR 2757

Recombinant Human EFNB2 Protein, His, E.coli-20ug

QP11754-20ug 20ug
EUR 201

Recombinant Human EFNB2 Protein, His, E.coli-5ug

QP11754-5ug 5ug
EUR 155

Recombinant Mouse EFNB2 Protein, His, Insect-1ug

QP11755-1ug 1ug
EUR 155

Recombinant Mouse EFNB2 Protein, His, Insect-50ug

QP11755-50ug 50ug
EUR 1261

Recombinant Mouse EFNB2 Protein, His, Insect-5ug

QP11755-5ug 5ug
EUR 201

Efnb2 3'UTR GFP Stable Cell Line

TU155644 1.0 ml Ask for price

Efnb2 3'UTR Luciferase Stable Cell Line

TU105644 1.0 ml Ask for price

Efnb2 3'UTR Luciferase Stable Cell Line

TU203823 1.0 ml Ask for price

Efnb2 3'UTR GFP Stable Cell Line

TU253823 1.0 ml Ask for price

EFNB2 3'UTR GFP Stable Cell Line

TU056661 1.0 ml
EUR 2333

EFNB2 3'UTR Luciferase Stable Cell Line

TU006661 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

EFNB2 Rabbit Polyclonal Antibody