PAK6 Rabbit Polyclonal Antibody

PAK6 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

PAK6 Polyclonal Antibody

ES8980-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAK6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAK6 Polyclonal Antibody

ABP59817-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180

PAK6 Polyclonal Antibody

ABP59817-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180

PAK6 Polyclonal Antibody

ABP59817-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180

PAK6 Rabbit pAb

A4871-100ul 100 ul
EUR 308

PAK6 Rabbit pAb

A4871-200ul 200 ul
EUR 459

PAK6 Rabbit pAb

A4871-20ul 20 ul Ask for price

PAK6 Rabbit pAb

A4871-50ul 50 ul Ask for price

PAK6 Rabbit pAb

A7821-100ul 100 ul
EUR 308

PAK6 Rabbit pAb

A7821-200ul 200 ul
EUR 459

PAK6 Rabbit pAb

A7821-20ul 20 ul
EUR 183

PAK6 Rabbit pAb

A7821-50ul 50 ul
EUR 223

Polyclonal PAK6 Antibody (Center)

APR17746G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK6 (Center). This antibody is tested and proven to work in the following applications:

PAK6 antibody

70R-51044 100 ul
EUR 244
Description: Purified Polyclonal PAK6 antibody

PAK6 Antibody

ABD10138 100 ug
EUR 438

PAK6 Antibody

35865-100ul 100ul
EUR 252

PAK6 Antibody

3927-100
EUR 316

PAK6 Antibody

3927-30T
EUR 146

PAK6 antibody

20R-PR073 50 ug
EUR 656
Description: Rabbit polyclonal PAK6 antibody

PAK6 Antibody

24181-100ul 100ul
EUR 390

PAK6 antibody

20R-1757 100 ug
EUR 673
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody

70R-19099 50 ul
EUR 435
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody

70R-12193 100 ug
EUR 403
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody

70R-14266 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal PAK6 antibody

PAK6 Antibody

1-CSB-PA927575
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PAK6 Antibody

1-CSB-PA971648
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:100

PAK6 Antibody

DF10138 200ul
EUR 304
Description: PAK6 Antibody detects endogenous levels of total PAK6.

PAK6 Antibody

1-CSB-PA865108ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PAK6 Antibody

1-CSB-PA017409GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PAK6 Conjugated Antibody

C35865 100ul
EUR 397

anti- PAK6 antibody

FNab06124 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: p21 protein (Cdc42/Rac)-activated kinase 6
  • Uniprot ID: Q9NQU5
  • Gene ID: 56924
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PAK6

PAK7 / PAK6 Antibody

20-abx325554
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PAK6 (pS165) Antibody

abx217623-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK7/PAK6 Antibody

1-CSB-PA040042
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK7/PAK6. Recognizes PAK7/PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

Anti-PAK6 antibody

PAab06124 100 ug
EUR 355

Anti-PAK6 Antibody

PA1729 100ug/vial
EUR 334

Anti-PAK6 antibody

STJ110131 100 µl
EUR 277
Description: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants.

Anti-PAK6 antibody

STJ24891 100 µl
EUR 277
Description: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants.

Anti-PAK6 antibody

STJ190138 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAK6

PAK6 siRNA

20-abx927649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAK6 siRNA

20-abx927650
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PAK6

YF-PA20072 50 ul
EUR 363
Description: Mouse polyclonal to PAK6

anti-PAK6

YF-PA20073 100 ug
EUR 403
Description: Rabbit polyclonal to PAK6

Phospho-PAK6 (Ser165) Antibody

AF8297 200ul
EUR 376
Description: PAK6 (Phospho-Ser165) Antibody detects endogenous levels of PAK6 only when phosphorylated at Ser165.

PAK6 (Phospho- Ser165) Antibody

ABF8297 100 ug
EUR 438

PAK6 Blocking Peptide

20-abx063919
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK6 Blocking Peptide

33R-10569 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK6 antibody, catalog no. 20R-1757

PAK6 Blocking Peptide

33R-11001 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK6 antibody, catalog no. 70R-12193

PAK6 Blocking Peptide

3927BP-50
EUR 153

PAK6 cloning plasmid

CSB-CL865108HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2046
  • Sequence: atgttccgcaagaaaaagaagaaacgccctgagatctcagcgccacagaacttccagcaccgtgtccacacctccttcgaccccaaagaaggcaagtttgtgggcctccccccacaatggcagaacatcctggacacactgcggcgccccaagcccgtggtggacccttcgcgaa
  • Show more
Description: A cloning plasmid for the PAK6 gene.

PAK6 Blocking Peptide

DF10138-BP 1mg
EUR 195

PAK7 / PAK6 (pS602 / S560) Antibody

20-abx325465
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PAK7 / PAK6 (pS602 / pS560) Antibody

abx333028-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx038429-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx048495-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx033771-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx033771-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

20-abx007072
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

20-abx008094
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

20-abx003695
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx026628-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx026628-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

20-abx320476
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

abx412258-50ug 50 ug
EUR 509
  • Shipped within 1 week.

P21 Activated Kinase 6 (PAK6) Antibody

abx236124-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

P21 Activated Kinase 6 (PAK6) Antibody

20-abx212643
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody

20-abx212829
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-PAK7/PAK6 (Ser602/Ser560) Antibody

CSB-PA285604-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (Ser602/Ser560). Recognizes Phospho-PAK7/PAK6 (Ser602/Ser560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PAK7/PAK6 (Ser602/Ser560) Antibody

CSB-PA285604-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (Ser602/Ser560). Recognizes Phospho-PAK7/PAK6 (Ser602/Ser560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PAK7/PAK6 (S602/S560) Antibody

1-CSB-PA040041
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (S602/S560). Recognizes Phospho-PAK7/PAK6 (S602/S560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Mouse PAK6 shRNA Plasmid

20-abx980853
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PAK6 ELISA KIT|Human

EF001537 96 Tests
EUR 689

Human PAK6 shRNA Plasmid

20-abx961226
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-PAK6 (Ser165) Blocking Peptide

AF8297-BP 1mg
EUR 195

PAK6 ORF Vector (Human) (pORF)

ORF007496 1.0 ug DNA
EUR 95

h PAK6 inducible lentiviral particles

LVP037 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PAK6, is fully sequence verified and matched to NCBI accession ID: NM_020168

Pak6 ORF Vector (Rat) (pORF)

ORF073069 1.0 ug DNA
EUR 506

Pak6 ORF Vector (Mouse) (pORF)

ORF053326 1.0 ug DNA
EUR 506

Pak6 ORF Vector (Mouse) (pORF)

ORF053327 1.0 ug DNA
EUR 506

PAK6 sgRNA CRISPR Lentivector set (Human)

K1590301 3 x 1.0 ug
EUR 339

Pak6 sgRNA CRISPR Lentivector set (Mouse)

K3622901 3 x 1.0 ug
EUR 339

Pak6 sgRNA CRISPR Lentivector set (Rat)

K6612101 3 x 1.0 ug
EUR 339

P21 Protein (Cdc42/Rac)-Activated Kinase 6 (PAK6) Antibody

20-abx114304
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PAK6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1590302 1.0 ug DNA
EUR 154

PAK6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1590303 1.0 ug DNA
EUR 154

PAK6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1590304 1.0 ug DNA
EUR 154

Pak6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3622902 1.0 ug DNA
EUR 154

Pak6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3622903 1.0 ug DNA
EUR 154

Pak6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3622904 1.0 ug DNA
EUR 154

Pak6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6612102 1.0 ug DNA
EUR 154

Pak6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6612103 1.0 ug DNA
EUR 154

Pak6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6612104 1.0 ug DNA
EUR 154

PAK6 Protein Vector (Human) (pPB-C-His)

PV029981 500 ng
EUR 329

PAK6 Protein Vector (Human) (pPB-N-His)

PV029982 500 ng
EUR 329

PAK6 Protein Vector (Human) (pPM-C-HA)

PV029983 500 ng
EUR 329

PAK6 Protein Vector (Human) (pPM-C-His)

PV029984 500 ng
EUR 329

PAK6 Protein Vector (Mouse) (pPB-C-His)

PV213302 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPB-N-His)

PV213303 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPM-C-HA)

PV213304 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPM-C-His)

PV213305 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPB-C-His)

PV213306 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPB-N-His)

PV213307 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPM-C-HA)

PV213308 500 ng
EUR 1065

PAK6 Protein Vector (Mouse) (pPM-C-His)

PV213309 500 ng
EUR 1065

PAK6 Protein Vector (Rat) (pPB-C-His)

PV292274 500 ng
EUR 1166

PAK6 Protein Vector (Rat) (pPB-N-His)

PV292275 500 ng
EUR 1166

PAK6 Protein Vector (Rat) (pPM-C-HA)

PV292276 500 ng
EUR 1166

PAK6 Protein Vector (Rat) (pPM-C-His)

PV292277 500 ng
EUR 1166

Pak6 3'UTR GFP Stable Cell Line

TU165865 1.0 ml Ask for price

PAK6 3'UTR Luciferase Stable Cell Line

TU017349 1.0 ml
EUR 1394

Pak6 3'UTR Luciferase Stable Cell Line

TU115865 1.0 ml Ask for price

PAK6 3'UTR GFP Stable Cell Line

TU067349 1.0 ml
EUR 1394

Pak6 3'UTR GFP Stable Cell Line

TU265777 1.0 ml Ask for price

Pak6 3'UTR Luciferase Stable Cell Line

TU215777 1.0 ml Ask for price

Anti-Phospho-PAK4 + PAK5 + PAK6 (S474 + S560 + S602) Monoclonal Antibody

MP01723 100ug
EUR 397
Description: Rabbit Monoclonal Phospho-PAK4 + PAK5 + PAK6 (S474 + S560 + S602) Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human P21 Activated Kinase 6 (PAK6) ELISA Kit

abx382038-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PAK6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640585 1.0 ug DNA
EUR 1355

PAK6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640589 1.0 ug DNA
EUR 1355

PAK6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640590 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PAK6 Rabbit Polyclonal Antibody