RXRA Rabbit Polyclonal Antibody

RXRA Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

RXRA Polyclonal Antibody
ES8964-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RXRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RXRA Polyclonal Antibody
ABP60285-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
RXRA Polyclonal Antibody
ABP60285-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
RXRA Polyclonal Antibody
ABP60285-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
RXRA Rabbit pAb
A3328-100ul 100 ul
EUR 308
RXRA Rabbit pAb
A3328-200ul 200 ul
EUR 459
RXRA Rabbit pAb
A3328-20ul 20 ul Ask for price
RXRA Rabbit pAb
A3328-50ul 50 ul Ask for price
RXRA Rabbit pAb
A15242-100ul 100 ul
EUR 308
RXRA Rabbit pAb
A15242-200ul 200 ul
EUR 459
RXRA Rabbit pAb
A15242-20ul 20 ul
EUR 183
RXRA Rabbit pAb
A15242-50ul 50 ul
EUR 223
Polyclonal RXRA Antibody (Center)
AMR09792G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXRA (Center). This antibody is tested and proven to work in the following applications:
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Hu-48T 48T
EUR 517
  • Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Hu-96T 96T
EUR 673
  • Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Mu-48T 48T
EUR 527
  • Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids.
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Mu-96T 96T
EUR 688
  • Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids.
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Hu-48Tests 48 Tests
EUR 521
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Hu-96Tests 96 Tests
EUR 723
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Mu-48Tests 48 Tests
EUR 533
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Mu-96Tests 96 Tests
EUR 740
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Hu-48Tests 48 Tests
EUR 544
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Hu-96Tests 96 Tests
EUR 756
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Mu-48Tests 48 Tests
EUR 557
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Mu-96Tests 96 Tests
EUR 774
RXRA Antibody
ABD8459 100 ug
EUR 438
RXRA Antibody
45310-100ul 100ul
EUR 252
RXRA Antibody
45310-50ul 50ul
EUR 187
RXRA antibody
70R-1922 50 ug
EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA
RXRA antibody
70R-1923 50 ug
EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the C terminal of RXRA
RXRA antibody
70R-1938 50 ug
EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA
RXRA antibody
70R-20052 50 ul
EUR 435
Description: Rabbit polyclonal RXRA antibody
RXRA Antibody
DF8459 200ul
EUR 304
Description: RXRA Antibody detects endogenous levels of total RXRA.
RXRA Antibody
1-CSB-PA020612GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RXRA. Recognizes RXRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RXRA Conjugated Antibody
C45310 100ul
EUR 397
anti- RXRA antibody
FNab07541 100µg
EUR 548.75
  • Immunogen: retinoid X receptor, alpha
  • Uniprot ID: P19793
  • Gene ID: 6256
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA
anti- RXRA antibody
FNab07542 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: retinoid X receptor, alpha
  • Uniprot ID: P19793
  • Gene ID: 6256
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA
anti- RXRA antibody
FNab07543 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: retinoid X receptor, alpha
  • Uniprot ID: P19793
  • Gene ID: 6256
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA
Anti-RXRA antibody
PAab07541 100 ug
EUR 386
Anti-RXRA antibody
PAab07542 100 ug
EUR 386
Anti-RXRA antibody
STJ25427 100 µl
EUR 277
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.
Anti-RXRA antibody
STJ117436 100 µl
EUR 277
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.
Anti-RXRA antibody
STJ190122 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RXRA
Rxra/ Rat Rxra ELISA Kit
ELI-06561r 96 Tests
EUR 886
RXRA siRNA
20-abx932322
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RXRA siRNA
20-abx932323
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RXRA cloning plasmid
CSB-CL020612HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atgcttggaagctggcctgccaggaccttccaccctggggcctgtgtcagccgccggccctccgcaccctggaagcacacggcctctgggaaggacagccctgaccttcggttttccgagcacggtgtttcccaagaattctgggctggcggcctggtggcagtgctggagatgac
  • Show more
Description: A cloning plasmid for the RXRA gene.
RXRA Blocking Peptide
33R-5845 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1923
RXRA Blocking Peptide
33R-2195 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1938
RXRA Blocking Peptide
33R-2196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1922
RXRA Blocking Peptide
DF8459-BP 1mg
EUR 195
Anti-RXRA (3F5)
YF-MA20216 200 ul
EUR 363
Description: Mouse monoclonal to RXRA
Retinoid X Receptor Alpha (RXRA) Antibody
20-abx002373
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Retinoid X Receptor Alpha (RXRA) Antibody
abx146131-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Retinoid X Receptor Alpha (RXRA) Antibody
abx032344-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Retinoid X Receptor Alpha (RXRA) Antibody
abx032344-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Retinoid X Receptor Alpha (RXRa) Antibody
20-abx174393
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Retinoid X Receptor Alpha (RXRa) Antibody
20-abx178260
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Retinoid X Receptor Alpha (RXRa) Antibody
20-abx178261
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Retinoid X Receptor Alpha (RXRa) Antibody
20-abx178262
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Retinoid X Receptor Alpha (RXRA) Antibody
20-abx218409
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Retinoid X Receptor Alpha (RXRA) Antibody
abx237541-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Retinoid X Receptor Alpha (RXRA) Antibody
abx237542-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Retinoid X Receptor Alpha (RXRA) Antibody
abx237543-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Human RXRA shRNA Plasmid
20-abx954212
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RXRA shRNA Plasmid
20-abx972539
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RXRA Recombinant Protein (Human)
RP027460 100 ug Ask for price
RXRA Recombinant Protein (Rat)
RP227321 100 ug Ask for price
RXRA Recombinant Protein (Mouse)
RP169745 100 ug Ask for price
Monoclonal RXRA Antibody (monoclonal) (M05), Clone: 1D7
AMR09793G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RXRA (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1D7. This antibody is applicable in WB
Monoclonal RXRA Antibody (monoclonal) (M07), Clone: 3A5
AMR09794G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RXRA (monoclonal) (M07). The antibodies are raised in mouse and are from clone 3A5. This antibody is applicable in WB and IF
Anti-Retinoid X Receptor alpha/RXRA Antibody
A01299-1 100ug/vial
EUR 334
RXRA ORF Vector (Human) (pORF)
ORF009154 1.0 ug DNA
EUR 95
h RXRA inducible lentiviral particles
LVP385 1 x107 IFU/ml x 200ul
EUR 451
Description: Pre-made inducible lentiviral particles for expressing human target: h RXRA (alternative name: NR2B1), with ORF sequence 100% matching to CDS region in NCBI ID: NM_002957.4.
Rxra ORF Vector (Mouse) (pORF)
ORF056583 1.0 ug DNA
EUR 506
Rxra ORF Vector (Rat) (pORF)
ORF075775 1.0 ug DNA
EUR 506
RXRA ELISA Kit (Human) (OKCD02857)
OKCD02857 96 Wells
EUR 831
Description: Description of target: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 33 pg/mL
RXRA ELISA Kit (Mouse) (OKEH03440)
OKEH03440 96 Wells
EUR 662
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.3 Publications;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL
RXRA ELISA Kit (Rat) (OKEH06066)
OKEH06066 96 Wells
EUR 766
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
RXRA ELISA Kit (Human) (OKEH07141)
OKEH07141 96 Wells
EUR 662
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL
RXRA sgRNA CRISPR Lentivector set (Human)
K2080501 3 x 1.0 ug
EUR 339
Rxra sgRNA CRISPR Lentivector set (Mouse)
K4425901 3 x 1.0 ug
EUR 339
Rxra sgRNA CRISPR Lentivector set (Rat)
K6799201 3 x 1.0 ug
EUR 339
Human Retinoid X Receptor Alpha (RXRa) Protein
20-abx654950
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Retinoid X Receptor Alpha (RXRa) Protein
20-abx654951
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Retinoid X Receptor Alpha (RXRa) Protein
20-abx654952
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
RXRA sgRNA CRISPR Lentivector (Human) (Target 1)
K2080502 1.0 ug DNA
EUR 154
RXRA sgRNA CRISPR Lentivector (Human) (Target 2)
K2080503 1.0 ug DNA
EUR 154
RXRA sgRNA CRISPR Lentivector (Human) (Target 3)
K2080504 1.0 ug DNA
EUR 154
Rxra sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4425902 1.0 ug DNA
EUR 154
Rxra sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4425903 1.0 ug DNA
EUR 154
Rxra sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4425904 1.0 ug DNA
EUR 154
Rxra sgRNA CRISPR Lentivector (Rat) (Target 1)
K6799202 1.0 ug DNA
EUR 154
Rxra sgRNA CRISPR Lentivector (Rat) (Target 2)
K6799203 1.0 ug DNA
EUR 154
Rxra sgRNA CRISPR Lentivector (Rat) (Target 3)
K6799204 1.0 ug DNA
EUR 154
RXRA Protein Vector (Human) (pPB-C-His)
PV036613 500 ng
EUR 329
RXRA Protein Vector (Human) (pPB-N-His)
PV036614 500 ng
EUR 329
RXRA Protein Vector (Human) (pPM-C-HA)
PV036615 500 ng
EUR 329
RXRA Protein Vector (Human) (pPM-C-His)
PV036616 500 ng
EUR 329
Recombinant Human RXRA Protein, Untagged, E.coli-10ug
QP13378-10ug 10ug
EUR 155
Recombinant Human RXRA Protein, Untagged, E.coli-1mg
QP13378-1mg 1mg
EUR 1859
Recombinant Human RXRA Protein, Untagged, E.coli-50ug
QP13378-50ug 50ug
EUR 201
RXRA Protein Vector (Rat) (pPB-C-His)
PV303098 500 ng
EUR 603
RXRA Protein Vector (Rat) (pPB-N-His)
PV303099 500 ng
EUR 603
RXRA Protein Vector (Rat) (pPM-C-HA)
PV303100 500 ng
EUR 603
RXRA Protein Vector (Rat) (pPM-C-His)
PV303101 500 ng
EUR 603
RXRA Protein Vector (Mouse) (pPB-C-His)
PV226330 500 ng
EUR 603
RXRA Protein Vector (Mouse) (pPB-N-His)
PV226331 500 ng
EUR 603
RXRA Protein Vector (Mouse) (pPM-C-HA)
PV226332 500 ng
EUR 603
RXRA Protein Vector (Mouse) (pPM-C-His)
PV226333 500 ng
EUR 603
Rxra 3'UTR GFP Stable Cell Line
TU168277 1.0 ml Ask for price
RXRA 3'UTR Luciferase Stable Cell Line
TU022501 1.0 ml
EUR 2333
Rxra 3'UTR Luciferase Stable Cell Line
TU118277 1.0 ml Ask for price
RXRA 3'UTR GFP Stable Cell Line
TU072501 1.0 ml
EUR 2333
Rxra 3'UTR Luciferase Stable Cell Line
TU219860 1.0 ml Ask for price
Rxra 3'UTR GFP Stable Cell Line
TU269860 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RXRA Rabbit Polyclonal Antibody