RXRA Rabbit Polyclonal Antibody

RXRA Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

RXRA Polyclonal Antibody
ES8964-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RXRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRA Polyclonal Antibody
ABP60285-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280 Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280

RXRA Polyclonal Antibody
ABP60285-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280 Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280

RXRA Polyclonal Antibody
ABP60285-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280 Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280

RXRA Rabbit pAb
A3328-100ul	Abclonal	100 ul	EUR 308

RXRA Rabbit pAb
A3328-200ul	Abclonal	200 ul	EUR 459

RXRA Rabbit pAb
A3328-20ul	Abclonal	20 ul	Ask for price

RXRA Rabbit pAb
A3328-50ul	Abclonal	50 ul	Ask for price

RXRA Rabbit pAb
A15242-100ul	Abclonal	100 ul	EUR 308

RXRA Rabbit pAb
A15242-200ul	Abclonal	200 ul	EUR 459

RXRA Rabbit pAb
A15242-20ul	Abclonal	20 ul	EUR 183

RXRA Rabbit pAb
A15242-50ul	Abclonal	50 ul	EUR 223

Polyclonal RXRA Antibody (Center)
AMR09792G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXRA (Center). This antibody is tested and proven to work in the following applications:

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Hu-48T	DL Develop	48T	EUR 517
Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Hu-96T	DL Develop	96T	EUR 673
Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids.

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
DLR-RXRa-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids.

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RD-RXRa-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit
RDR-RXRa-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

RXRA Antibody
ABD8459	Lifescience Market	100 ug	EUR 438

RXRA Antibody
45310-100ul	SAB	100ul	EUR 252

RXRA Antibody
45310-50ul	SAB	50ul	EUR 187

RXRA antibody
70R-1922	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA

RXRA antibody
70R-1923	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the C terminal of RXRA

RXRA antibody
70R-1938	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA

RXRA antibody
70R-20052	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RXRA antibody

RXRA Antibody
DF8459	Affbiotech	200ul	EUR 304
Description: RXRA Antibody detects endogenous levels of total RXRA.

RXRA Antibody
1-CSB-PA020612GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RXRA. Recognizes RXRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RXRA Conjugated Antibody
C45310	SAB	100ul	EUR 397

anti- RXRA antibody
FNab07541	FN Test	100µg	EUR 548.75
Immunogen: retinoid X receptor, alpha Uniprot ID: P19793 Gene ID: 6256 Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA

anti- RXRA antibody
FNab07542	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IP: 1:200-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: retinoid X receptor, alpha Uniprot ID: P19793 Gene ID: 6256 Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA

anti- RXRA antibody
FNab07543	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 Immunogen: retinoid X receptor, alpha Uniprot ID: P19793 Gene ID: 6256 Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA

Anti-RXRA antibody
PAab07541	Lifescience Market	100 ug	EUR 386

Anti-RXRA antibody
PAab07542	Lifescience Market	100 ug	EUR 386

Anti-RXRA antibody
STJ25427	St John's Laboratory	100 µl	EUR 277
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.

Anti-RXRA antibody
STJ117436	St John's Laboratory	100 µl	EUR 277
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.

Anti-RXRA antibody
STJ190122	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RXRA

Rxra/ Rat Rxra ELISA Kit
ELI-06561r	Lifescience Market	96 Tests	EUR 886

RXRA siRNA
20-abx932322	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXRA siRNA
20-abx932323	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXRA cloning plasmid
CSB-CL020612HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 498 Sequence: atgcttggaagctggcctgccaggaccttccaccctggggcctgtgtcagccgccggccctccgcaccctggaagcacacggcctctgggaaggacagccctgaccttcggttttccgagcacggtgtttcccaagaattctgggctggcggcctggtggcagtgctggagatgac Show more
Description: A cloning plasmid for the RXRA gene.

RXRA Blocking Peptide
33R-5845	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1923

RXRA Blocking Peptide
33R-2195	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1938

RXRA Blocking Peptide
33R-2196	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1922

RXRA Blocking Peptide
DF8459-BP	Affbiotech	1mg	EUR 195

Anti-RXRA (3F5)
YF-MA20216	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to RXRA

Retinoid X Receptor Alpha (RXRA) Antibody
20-abx002373	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRA) Antibody
abx146131-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRA) Antibody
abx032344-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRA) Antibody
abx032344-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRa) Antibody
20-abx174393	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Retinoid X Receptor Alpha (RXRa) Antibody
20-abx178260	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Retinoid X Receptor Alpha (RXRa) Antibody
20-abx178261	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Retinoid X Receptor Alpha (RXRa) Antibody
20-abx178262	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Retinoid X Receptor Alpha (RXRA) Antibody
20-abx218409	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRA) Antibody
abx237541-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Retinoid X Receptor Alpha (RXRA) Antibody
abx237542-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Retinoid X Receptor Alpha (RXRA) Antibody
abx237543-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human RXRA shRNA Plasmid
20-abx954212	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RXRA shRNA Plasmid
20-abx972539	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RXRA Recombinant Protein (Human)
RP027460	ABM	100 ug	Ask for price

RXRA Recombinant Protein (Rat)
RP227321	ABM	100 ug	Ask for price

RXRA Recombinant Protein (Mouse)
RP169745	ABM	100 ug	Ask for price

Monoclonal RXRA Antibody (monoclonal) (M05), Clone: 1D7
AMR09793G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RXRA (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1D7. This antibody is applicable in WB

Monoclonal RXRA Antibody (monoclonal) (M07), Clone: 3A5
AMR09794G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RXRA (monoclonal) (M07). The antibodies are raised in mouse and are from clone 3A5. This antibody is applicable in WB and IF

Anti-Retinoid X Receptor alpha/RXRA Antibody
A01299-1	BosterBio	100ug/vial	EUR 334

RXRA ORF Vector (Human) (pORF)
ORF009154	ABM	1.0 ug DNA	EUR 95

h RXRA inducible lentiviral particles
LVP385	GenTarget	1 x107 IFU/ml x 200ul	EUR 451
Description: Pre-made inducible lentiviral particles for expressing human target: h RXRA (alternative name: NR2B1), with ORF sequence 100% matching to CDS region in NCBI ID: NM_002957.4.

Rxra ORF Vector (Mouse) (pORF)
ORF056583	ABM	1.0 ug DNA	EUR 506

Rxra ORF Vector (Rat) (pORF)
ORF075775	ABM	1.0 ug DNA	EUR 506

RXRA ELISA Kit (Human) (OKCD02857)
OKCD02857	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 33 pg/mL

RXRA ELISA Kit (Mouse) (OKEH03440)
OKEH03440	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.3 Publications;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

RXRA ELISA Kit (Rat) (OKEH06066)
OKEH06066	Aviva Systems Biology	96 Wells	EUR 766
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

RXRA ELISA Kit (Human) (OKEH07141)
OKEH07141	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

RXRA sgRNA CRISPR Lentivector set (Human)
K2080501	ABM	3 x 1.0 ug	EUR 339

Rxra sgRNA CRISPR Lentivector set (Mouse)
K4425901	ABM	3 x 1.0 ug	EUR 339

Rxra sgRNA CRISPR Lentivector set (Rat)
K6799201	ABM	3 x 1.0 ug	EUR 339

Human Retinoid X Receptor Alpha (RXRa) Protein
20-abx654950	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Retinoid X Receptor Alpha (RXRa) Protein
20-abx654951	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Retinoid X Receptor Alpha (RXRa) Protein
20-abx654952	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

RXRA sgRNA CRISPR Lentivector (Human) (Target 1)
K2080502	ABM	1.0 ug DNA	EUR 154

RXRA sgRNA CRISPR Lentivector (Human) (Target 2)
K2080503	ABM	1.0 ug DNA	EUR 154

RXRA sgRNA CRISPR Lentivector (Human) (Target 3)
K2080504	ABM	1.0 ug DNA	EUR 154

Rxra sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4425902	ABM	1.0 ug DNA	EUR 154

Rxra sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4425903	ABM	1.0 ug DNA	EUR 154

Rxra sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4425904	ABM	1.0 ug DNA	EUR 154

Rxra sgRNA CRISPR Lentivector (Rat) (Target 1)
K6799202	ABM	1.0 ug DNA	EUR 154

Rxra sgRNA CRISPR Lentivector (Rat) (Target 2)
K6799203	ABM	1.0 ug DNA	EUR 154

Rxra sgRNA CRISPR Lentivector (Rat) (Target 3)
K6799204	ABM	1.0 ug DNA	EUR 154

RXRA Protein Vector (Human) (pPB-C-His)
PV036613	ABM	500 ng	EUR 329

RXRA Protein Vector (Human) (pPB-N-His)
PV036614	ABM	500 ng	EUR 329

RXRA Protein Vector (Human) (pPM-C-HA)
PV036615	ABM	500 ng	EUR 329

RXRA Protein Vector (Human) (pPM-C-His)
PV036616	ABM	500 ng	EUR 329

Recombinant Human RXRA Protein, Untagged, E.coli-10ug
QP13378-10ug	EnQuireBio	10ug	EUR 155

Recombinant Human RXRA Protein, Untagged, E.coli-1mg
QP13378-1mg	EnQuireBio	1mg	EUR 1859

Recombinant Human RXRA Protein, Untagged, E.coli-50ug
QP13378-50ug	EnQuireBio	50ug	EUR 201

RXRA Protein Vector (Rat) (pPB-C-His)
PV303098	ABM	500 ng	EUR 603

RXRA Protein Vector (Rat) (pPB-N-His)
PV303099	ABM	500 ng	EUR 603

RXRA Protein Vector (Rat) (pPM-C-HA)
PV303100	ABM	500 ng	EUR 603

RXRA Protein Vector (Rat) (pPM-C-His)
PV303101	ABM	500 ng	EUR 603

RXRA Protein Vector (Mouse) (pPB-C-His)
PV226330	ABM	500 ng	EUR 603

RXRA Protein Vector (Mouse) (pPB-N-His)
PV226331	ABM	500 ng	EUR 603

RXRA Protein Vector (Mouse) (pPM-C-HA)
PV226332	ABM	500 ng	EUR 603

RXRA Protein Vector (Mouse) (pPM-C-His)
PV226333	ABM	500 ng	EUR 603

Rxra 3'UTR GFP Stable Cell Line
TU168277	ABM	1.0 ml	Ask for price

RXRA 3'UTR Luciferase Stable Cell Line
TU022501	ABM	1.0 ml	EUR 2333

Rxra 3'UTR Luciferase Stable Cell Line
TU118277	ABM	1.0 ml	Ask for price

RXRA 3'UTR GFP Stable Cell Line
TU072501	ABM	1.0 ml	EUR 2333

Rxra 3'UTR Luciferase Stable Cell Line
TU219860	ABM	1.0 ml	Ask for price

Rxra 3'UTR GFP Stable Cell Line
TU269860	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RXRA Rabbit Polyclonal Antibody