CD70 Rabbit Polyclonal Antibody

CD70 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

CD70 Polyclonal Antibody

ABP50916-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of CD70 from Human. This CD70 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120

CD70 Polyclonal Antibody

ABP50916-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of CD70 from Human. This CD70 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD70 at AA range: 40-120

CD70 Polyclonal Antibody

ABP58073-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193
  • Applications tips:
Description: A polyclonal antibody for detection of CD70 from Human, Mouse. This CD70 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193

CD70 Polyclonal Antibody

ABP58073-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193
  • Applications tips:
Description: A polyclonal antibody for detection of CD70 from Human, Mouse. This CD70 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193

CD70 Polyclonal Antibody

ABP58073-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193
  • Applications tips:
Description: A polyclonal antibody for detection of CD70 from Human, Mouse. This CD70 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD70 protein at amino acid sequence of 150-193

CD70 Polyclonal Antibody

ES8789-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD70 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CD70 Polyclonal Antibody

ES8789-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD70 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CD70 Polyclonal Antibody

ES1915-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD70 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD70 Polyclonal Antibody

ES1915-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD70 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit CD70 antigen(CD70) ELISA kit

E04C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD70 antigen(CD70) ELISA kit

E04C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD70 antigen(CD70) ELISA kit

E04C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CD70 Rabbit pAb

A2032-100ul 100 ul
EUR 308

CD70 Rabbit pAb

A2032-200ul 200 ul
EUR 459

CD70 Rabbit pAb

A2032-20ul 20 ul
EUR 183

CD70 Rabbit pAb

A2032-50ul 50 ul
EUR 223

CD70 Rabbit pAb

A16698-100ul 100 ul
EUR 308

CD70 Rabbit pAb

A16698-200ul 200 ul
EUR 459

CD70 Rabbit pAb

A16698-20ul 20 ul
EUR 183

CD70 Rabbit pAb

A16698-50ul 50 ul
EUR 223

CD70 Rabbit pAb

A16809-100ul 100 ul
EUR 308

CD70 Rabbit pAb

A16809-200ul 200 ul
EUR 459

CD70 Rabbit pAb

A16809-20ul 20 ul
EUR 183

CD70 Rabbit pAb

A16809-50ul 50 ul
EUR 223

Polyclonal CD70 Antibody (Center)

APR04006G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD70 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CD27L / CD70 Antibody (Internal)

APR02113G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD27L / CD70 (Internal). This antibody is tested and proven to work in the following applications:

CD70 antibody

70R-10290 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CD70 antibody

CD70 antibody

70R-13191 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CD70 antibody

CD70 Antibody

35213-100ul 100ul
EUR 252

CD70 Antibody

35213-50ul 50ul
EUR 187

CD70 Antibody

32562-100ul 100ul
EUR 252

CD70 antibody

10R-CD70bHU 100 ug
EUR 404
Description: Mouse monoclonal CD70 antibody

CD70 antibody

10-2490 100 ug
EUR 241
Description: Mouse monoclonal CD70 antibody

CD70 antibody

10R-6434 100 ug
EUR 192
Description: Rat monoclonal CD70 antibody

CD70 Antibody

43184-100ul 100ul
EUR 252

CD70 Antibody

CSB-PA004954KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CD70 Antibody

CSB-PA004954KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CD70 Antibody

1-CSB-PA001476
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

CD70 Antibody

1-CSB-PA068483
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

CD70 Antibody

1-CSB-PA08009A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CD70 Antibody

CSB-PA095181-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CD70 Antibody

CSB-PA095181-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CD70 Antibody

1-CSB-PA615999
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CD70 Antibody

DF4696 200ul
EUR 304
Description: CD70 Antibody detects endogenous levels of total CD70.

CD70 Antibody

DF6766 200ul
EUR 304
Description: CD70 Antibody detects endogenous levels of total CD70.

CD70 antibody

70R-49507 100 ul
EUR 244
Description: Purified Polyclonal CD70 antibody

CD70 Antibody

AF5265 200ul
EUR 304
Description: CD70 Antibody detects endogenous levels of total CD70.

CD70 Antibody

ABD4696 100 ug
EUR 438

CD70 Antibody

ABD6766 100 ug
EUR 438

CD70 Antibody

ABF5265 100 ug
EUR 438

Human CD70 antigen (CD70)

1-CSB-YP004954HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human CD70 antigen(CD70),partial expressed in Yeast

Human CD70 Antibody

33274-05111 150 ug
EUR 261

CD70 antibody (PE)

61R-1271 100 ug
EUR 354
Description: Rat monoclonal CD70 antibody (PE)

CD70 antibody (FITC)

61R-CD70bHUFT 120 tests
EUR 403
Description: Mouse monoclonal CD70 antibody (FITC)

CD70 antibody (PE)

61R-CD70bHUPE 120 tests
EUR 629
Description: Mouse monoclonal CD70 antibody (PE)

CD70(BU69) Antibody

BNUB0187-100 100uL
EUR 209
Description: Primary antibody against CD70(BU69), Concentration: 0.2mg/mL

CD70(BU69) Antibody

BNUB0187-500 500uL
EUR 458
Description: Primary antibody against CD70(BU69), Concentration: 0.2mg/mL

CD70(BU69) Antibody

BNUM0187-50 50uL
EUR 395
Description: Primary antibody against CD70(BU69), 1mg/mL

CD70(BU69) Antibody

BNC040187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF405S conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC040187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF405S conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC610187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF660R conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC610187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF660R conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC470187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF647 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC470187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF647 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC550187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF555 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC550187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF555 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC050187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF405M conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC050187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF405M conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC400187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF640R conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC400187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF640R conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC430187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF543 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC430187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF543 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC800187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF680 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC800187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF680 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC810187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF680R conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC810187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF680R conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCP0187-250 250uL
EUR 383
Description: Primary antibody against CD70(BU69), PerCP conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCR0187-250 250uL
EUR 383
Description: Primary antibody against CD70(BU69), RPE conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCA0187-250 250uL
EUR 383
Description: Primary antibody against CD70(BU69), APC conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCAP0187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCAP0187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCH0187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCH0187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC940187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF594 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC940187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF594 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC700187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF770 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC700187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF770 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCB0187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), Biotin conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNCB0187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), Biotin conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC880187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF488A conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC880187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF488A conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC680187-100 100uL
EUR 199
Description: Primary antibody against CD70(BU69), CF568 conjugate, Concentration: 0.1mg/mL

CD70(BU69) Antibody

BNC680187-500 500uL
EUR 544
Description: Primary antibody against CD70(BU69), CF568 conjugate, Concentration: 0.1mg/mL

Anti-CD70 antibody

STJ119120 100 µl
EUR 277

Anti-CD70 antibody

STJ119200 100 µl
EUR 277

Anti-CD70 antibody

STJ92139 200 µl
EUR 197
Description: Rabbit polyclonal to CD70.

Anti-CD70 antibody

STJ23009 100 µl
EUR 277
Description: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis.

Anti-CD70 antibody

STJ98994 200 µl
EUR 197
Description: Rabbit polyclonal to CD70.

Rat CD70 antigen(CD70) ELISA kit

E02C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD70 antigen(CD70) ELISA kit

E02C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD70 antigen(CD70) ELISA kit

E02C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD70/ CD70 antigen ELISA Kit

E0439Hu 1 Kit
EUR 605

Goat CD70 antigen(CD70) ELISA kit

E06C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD70 antigen(CD70) ELISA kit

E06C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD70 antigen(CD70) ELISA kit

E06C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD70 antigen(CD70) ELISA kit

E03C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD70 antigen(CD70) ELISA kit

E03C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD70 antigen(CD70) ELISA kit

E03C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD70 antigen(CD70) ELISA kit

E01C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD70 antigen(CD70) ELISA kit

E01C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD70 antigen(CD70) ELISA kit

E01C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD70 antigen(CD70) ELISA kit

E07C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD70 antigen(CD70) ELISA kit

E07C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD70 antigen(CD70) ELISA kit

E07C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD70 antigen(CD70) ELISA kit

E09C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD70 antigen(CD70) ELISA kit

E09C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD70 antigen(CD70) ELISA kit

E09C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD70 antigen(CD70) ELISA kit

E08C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD70 antigen(CD70) ELISA kit

E08C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD70 antigen(CD70) ELISA kit

E08C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD70 antigen, Cd70 ELISA KIT

ELI-25765m 96 Tests
EUR 865

Human CD70 antigen(CD70) ELISA kit

CSB-EL004954HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD70 antigen (CD70) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CD70 antigen(CD70) ELISA kit

1-CSB-EL004954HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD70 antigen(CD70) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse CD70 antigen(CD70) ELISA kit

CSB-EL004954MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse CD70 antigen (CD70) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse CD70 antigen(CD70) ELISA kit

1-CSB-EL004954MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse CD70 antigen(CD70) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Porcine CD70 antigen, CD70 ELISA KIT

ELI-34079p 96 Tests
EUR 928

Human CD70 antigen, CD70 ELISA KIT

ELI-50451h 96 Tests
EUR 824

CD70 siRNA

20-abx911065
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD70 siRNA

20-abx911066
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CD70

YF-PA10815 50 ug
EUR 363
Description: Mouse polyclonal to CD70

anti-CD70

YF-PA10816 100 ul
EUR 403
Description: Rabbit polyclonal to CD70

CD27L (CD27L (CD70)) antibody

22409-100ul 100ul
EUR 390

CD70 antibody (Preservative Free)

10R-CD70bHUP 100 ug
EUR 1448
Description: Mouse monoclonal CD70 antibody (Preservative Free)

CD70 Antibody, HRP conjugated

1-CSB-PA08009B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD70 Antibody, FITC conjugated

1-CSB-PA08009C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD70 Antibody, Biotin conjugated

1-CSB-PA08009D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD70. Recognizes CD70 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CD70/Cd27L Antibody

A02853 100ul
EUR 397
Description: Rabbit Polyclonal CD70/Cd27L Antibody. Validated in WB and tested in Human.

CD70(TNFS7/1026) Antibody

BNUM1026-50 50uL
EUR 395
Description: Primary antibody against CD70(TNFS7/1026), 1mg/mL

CD70(TNFS7/1026) Antibody

BNUB1026-100 100uL
EUR 209
Description: Primary antibody against CD70(TNFS7/1026), Concentration: 0.2mg/mL

CD70(TNFS7/1026) Antibody

BNUB1026-500 500uL
EUR 458
Description: Primary antibody against CD70(TNFS7/1026), Concentration: 0.2mg/mL

CD70(TNFS7/1026) Antibody

BNC551026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF555 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC551026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF555 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC611026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF660R conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC611026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF660R conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC471026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF647 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC471026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF647 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC051026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF405M conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC051026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF405M conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC401026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF640R conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC401026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF640R conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC431026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF543 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC431026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF543 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC041026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF405S conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC041026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF405S conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC801026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF680 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC801026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF680 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCP1026-250 250uL
EUR 383
Description: Primary antibody against CD70(TNFS7/1026), PerCP conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCR1026-250 250uL
EUR 383
Description: Primary antibody against CD70(TNFS7/1026), RPE conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCA1026-250 250uL
EUR 383
Description: Primary antibody against CD70(TNFS7/1026), APC conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCAP1026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCAP1026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCB1026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), Biotin conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCB1026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), Biotin conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCH1026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNCH1026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC881026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF488A conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC881026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF488A conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC941026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF594 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC941026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF594 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC681026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF568 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC681026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF568 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC701026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF770 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC701026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF770 conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC811026-100 100uL
EUR 199
Description: Primary antibody against CD70(TNFS7/1026), CF680R conjugate, Concentration: 0.1mg/mL

CD70(TNFS7/1026) Antibody

BNC811026-500 500uL
EUR 544
Description: Primary antibody against CD70(TNFS7/1026), CF680R conjugate, Concentration: 0.1mg/mL

Guinea pig CD70 antigen(CD70) ELISA kit

E05C1493-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD70 antigen(CD70) ELISA kit

E05C1493-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD70 antigen(CD70) ELISA kit

E05C1493-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CD70 antigen(CD70) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD70 Antigen / TNFSF7 (CD70) ELISA Kit

20-abx153329
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human CD70 Antigen / TNFSF7 (CD70) ELISA Kit

abx555551-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse CD70 Antigen / TNFSF7 (CD70) ELISA Kit

abx555613-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig CD70 Antigen / TNFSF7 (CD70) ELISA Kit

abx555675-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human CD70 Antibody (Biotin Conjugate)

33274-05121 150 ug
EUR 369

CD70 Blocking Peptide

33R-10423 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD70 antibody, catalog no. 70R-10290

CD70 Blocking Peptide

DF4696-BP 1mg
EUR 195

CD70 Blocking Peptide

DF6766-BP 1mg
EUR 195

CD70 Blocking Peptide

20-abx062382
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CD70 Blocking Peptide

AF5265-BP 1mg
EUR 195

CD70 cloning plasmid

CSB-CL004954HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 582
  • Sequence: atgccggaggagggttcgggctgctcggtgcggcgcaggccctatgggtgcgtcctgcgggctgctttggtcccattggtcgcgggcttggtgatctgcctcgtggtgtgcatccagcgcttcgcacaggctcagcagcagctgccgctcgagtcacttgggtgggacgtagctga
  • Show more
Description: A cloning plasmid for the CD70 gene.

Human CD70 AssayLite Antibody (FITC Conjugate)

33274-05141 150 ug
EUR 428

Human CD70 AssayLite Antibody (RPE Conjugate)

33274-05151 150 ug
EUR 428

Human CD70 AssayLite Antibody (APC Conjugate)

33274-05161 150 ug
EUR 428

Human CD70 AssayLite Antibody (PerCP Conjugate)

33274-05171 150 ug
EUR 471

Cluster of Differentiation 70 (CD70) Antibody

20-abx009469
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

abx028268-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

abx028268-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

20-abx015078
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

20-abx210301
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

20-abx210634
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

abx117179-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

abx139325-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

Rat Anti Mouse Cd70 Monoclonal Antibody

CABT-46652RM 0.1 mg
EUR 455

Cluster of Differentiation 70 (CD70) Antibody

abx413338-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Cluster of Differentiation 70 (CD70) Antibody

abx413339-25ug 25 ug
EUR 272
  • Shipped within 1 week.

Cluster of Differentiation 70 (CD70) Antibody

abx330868-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

20-abx323908
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster Of Differentiation 70 (CD70) Antibody

20-abx300992
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster of Differentiation 70 (CD70) Antibody

20-abx001649
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Hu CD70 Purified

11-154-C025 0.025 mg
EUR 99

Anti-Hu CD70 Purified

11-154-C100 0.1 mg
EUR 158

Anti-Hu CD70 PE

1P-154-T025 25 tests
EUR 140

Anti-Hu CD70 PE

1P-154-T100 100 tests
EUR 240

CD70 protein (His tag)

80R-4132 100 ug
EUR 327
Description: Recombinant Human CD70 protein (His tag)

Anti-CD70-DM1 ADC

ADC-W-567 1mg Ask for price
Description: This ADC product is comprised of an anti-CD70 monoclonal antibody conjugated via a linker to DM1

Mouse CD70 shRNA Plasmid

20-abx973169
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD70 shRNA Plasmid

20-abx950691
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD70 Recombinant Protein (Human)

RP006409 100 ug Ask for price

Recombinant Human CD70 Protein

RP01129 5 μg
EUR 145

CD70 Rabbit Polyclonal Antibody