CTBP1 Rabbit Polyclonal Antibody

CTBP1 Rabbit Polyclonal Antibody

To Order Now: info@pollen-tech.com

Polyclonal CTBP1 Antibody
APR00199G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CTBP1 . This antibody is tested and proven to work in the following applications:
CTBP1 Polyclonal Antibody
A-2705 100 µl
EUR 483.55
Description: The best epigenetics products
CTBP1 Polyclonal Antibody
ABP58287-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CTBP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of CTBP1 from Human, Mouse, Rat. This CTBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CTBP1 protein at amino acid sequence of 100-180
CTBP1 Polyclonal Antibody
ABP58287-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CTBP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of CTBP1 from Human, Mouse, Rat. This CTBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CTBP1 protein at amino acid sequence of 100-180
CTBP1 Polyclonal Antibody
ABP58287-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CTBP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of CTBP1 from Human, Mouse, Rat. This CTBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CTBP1 protein at amino acid sequence of 100-180
CtBP1 Polyclonal Antibody
ABP53884-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human CtBP1 around the non-phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP1 from Human, Mouse, Rat. This CtBP1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CtBP1 around the non-phosphorylation site of S422
CtBP1 Polyclonal Antibody
ABP53884-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human CtBP1 around the non-phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP1 from Human, Mouse, Rat. This CtBP1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CtBP1 around the non-phosphorylation site of S422
CtBP1 Polyclonal Antibody
ABP53884-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human CtBP1 around the non-phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP1 from Human, Mouse, Rat. This CtBP1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CtBP1 around the non-phosphorylation site of S422
CtBP1 Polyclonal Antibody
ES4883-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CtBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CtBP1 Polyclonal Antibody
ES4883-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CtBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CTBP1 Polyclonal Antibody
ES8973-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CTBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CTBP1 Polyclonal Antibody
ES8973-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CTBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CtBP1 Rabbit mAb
A11600-100ul 100 ul
EUR 410
CtBP1 Rabbit mAb
A11600-200ul 200 ul
EUR 571
CtBP1 Rabbit mAb
A11600-20ul 20 ul
EUR 221
CtBP1 Rabbit mAb
A11600-50ul 50 ul
EUR 287
CTBP1 Rabbit pAb
A14616-100ul 100 ul
EUR 308
CTBP1 Rabbit pAb
A14616-200ul 200 ul
EUR 459
CTBP1 Rabbit pAb
A14616-20ul 20 ul
EUR 183
CTBP1 Rabbit pAb
A14616-50ul 50 ul
EUR 223
CTBP1 Rabbit pAb
A3257-100ul 100 ul
EUR 308
CTBP1 Rabbit pAb
A3257-200ul 200 ul
EUR 459
CTBP1 Rabbit pAb
A3257-20ul 20 ul
EUR 183
CTBP1 Rabbit pAb
A3257-50ul 50 ul
EUR 223
CTBP1 Rabbit pAb
A1707-100ul 100 ul
EUR 308
CTBP1 Rabbit pAb
A1707-200ul 200 ul
EUR 459
CTBP1 Rabbit pAb
A1707-20ul 20 ul
EUR 183
CTBP1 Rabbit pAb
A1707-50ul 50 ul
EUR 223
Polyclonal CTBP1 Antibody (C-term)
APR03494G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CTBP1 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal CTBP1 Antibody (C-term)
APR04058G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CTBP1 (C-term). This antibody is tested and proven to work in the following applications:
CtBP1 (phospho Ser422) Polyclonal Antibody
ABP53883-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human CtBP1 around the phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP1 phospho Ser422) from Human, Mouse, Rat. This CtBP1 phospho Ser422) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CtBP1 around the phosphorylation site of S422
CtBP1 (phospho Ser422) Polyclonal Antibody
ABP53883-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human CtBP1 around the phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP1 phospho Ser422) from Human, Mouse, Rat. This CtBP1 phospho Ser422) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CtBP1 around the phosphorylation site of S422
CtBP1 (phospho Ser422) Polyclonal Antibody
ABP53883-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human CtBP1 around the phosphorylation site of S422
  • Applications tips:
Description: A polyclonal antibody for detection of CtBP1 phospho Ser422) from Human, Mouse, Rat. This CtBP1 phospho Ser422) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CtBP1 around the phosphorylation site of S422
CtBP1 (phospho Ser422) Polyclonal Antibody
ES4882-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CtBP1 (phospho Ser422) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CtBP1 (phospho Ser422) Polyclonal Antibody
ES4882-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CtBP1 (phospho Ser422) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CTBP1 antibody
22807-100ul 100ul
EUR 390
CTBP1 antibody
70R-16640 50 ul
EUR 435
Description: Rabbit polyclonal CTBP1 antibody
CTBP1 antibody
70R-12095 100 ul
EUR 403
Description: Rabbit polyclonal CTBP1 antibody
CtBP1 antibody
70R-12607 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CtBP1 antibody
CTBP1 antibody
70R-14107 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CTBP1 antibody
CTBP1 Antibody
32397-100ul 100ul
EUR 252
CTBP1 Antibody
3796-100
EUR 316
CTBP1 antibody
10R-1770 100 ul
EUR 316
Description: Mouse Monoclonal CTBP1 antibody
CtBP1 Antibody
49960-100ul 100ul
EUR 333
CtBP1 Antibody
49960-50ul 50ul
EUR 239
CTBP1 Antibody
43242-100ul 100ul
EUR 252
CTBP1 Antibody
1-CSB-PA006135GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CTBP1 Antibody
1-CSB-PA618772ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000
CTBP1 Antibody
1-CSB-PA783700
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
CTBP1 Antibody
DF6568 200ul
EUR 304
Description: CTBP1 Antibody detects endogenous levels of total CTBP1.
CTBP1 Antibody
1-CSB-PA572404
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:250
CTBP1 Antibody
1-CSB-PA170398
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
CTBP1 Antibody
1-CSB-PA243683
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
CtBP1 antibody
70R-34497 100 ug
EUR 327
Description: Rabbit polyclonal CtBP1 antibody
CtBP1 Antibody
AF0795 200ul
EUR 304
Description: CtBP1 Antibody detects endogenous levels of CtBP1.
CTBP1 Antibody
1-CSB-PA007413
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CTBP1. Recognizes CTBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
CTBP1 Antibody
ABD6568 100 ug
EUR 438
CtBP1 Antibody
ABF0795 100 ug
EUR 438
Polyclonal CTBP1 / CTBP Antibody (aa388-437)
APR02996G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CTBP1 / CTBP (aa388-437). This antibody is tested and proven to work in the following applications:
CtBP1 (Phospho-Ser422) Polyclonal Conjugated Antibody
C11796 100ul
EUR 397
Human CtBP1 Antibody
32053-05111 150 ug
EUR 261
CtBP1/2 Antibody
DF10353 200ul
EUR 304
Description: CtBP1/2 Antibody detects endogenous levels of CtBP1/2.
CtBP1 antibody (Ser422)
70R-34496 100 ug
EUR 327
Description: Rabbit polyclonal CtBP1 antibody (Ser422)
CtBP1 (pS422) Antibody
abx012066-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
CtBP1 Conjugated Antibody
C49960 100ul
EUR 397
CTBP1 Conjugated Antibody
C43242 100ul
EUR 397
CTBP1 (pS422) Antibody
abx333255-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
anti- CTBP1 antibody
FNab02046 100µg
EUR 548.75
  • Immunogen: C-terminal binding protein 1
  • Uniprot ID: Q13363
  • Gene ID: 1487
  • Research Area: Metabolism
Description: Antibody raised against CTBP1
Anti-CtBP1 Antibody
PA1570 100ug/vial
EUR 334
Anti-CTBP1 antibody
PAab02046 100 ug
EUR 386
Anti-CtBP1 Antibody
PB9425 100ug/vial
EUR 334
Anti-CTBP1 antibody
STJ116825 100 µl
EUR 277
Description: This gene encodes a protein that binds to the C-terminus of adenovirus E1A proteins. This phosphoprotein is a transcriptional repressor and may play a role during cellular proliferation. This protein and the product of a second closely related gene, CTBP2, can dimerize. Both proteins can also interact with a polycomb group protein complex which participates in regulation of gene expression during development. Alternative splicing of transcripts from this gene results in multiple transcript variants.
Anti-CtBP1 antibody
STJ92513 200 µl
EUR 197
Description: Rabbit polyclonal to CtBP1.
Anti-CTBP1 antibody
STJ23254 100 µl
EUR 277
Description: This gene encodes a protein that binds to the C-terminus of adenovirus E1A proteins. This phosphoprotein is a transcriptional repressor and may play a role during cellular proliferation. This protein and the product of a second closely related gene, CTBP2, can dimerize. Both proteins can also interact with a polycomb group protein complex which participates in regulation of gene expression during development. Alternative splicing of transcripts from this gene results in multiple transcript variants.
Anti-CTBP1 antibody
STJ23256 100 µl
EUR 277
Description: This gene encodes a protein that binds to the C-terminus of adenovirus E1A proteins. This phosphoprotein is a transcriptional repressor and may play a role during cellular proliferation. This protein and the product of a second closely related gene, CTBP2, can dimerize. Both proteins can also interact with a polycomb group protein complex which participates in regulation of gene expression during development. Alternative splicing of transcripts from this gene results in multiple transcript variants.
Anti-CTBP1 antibody
STJ190131 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CTBP1
Ctbp1/ Rat Ctbp1 ELISA Kit
ELI-32973r 96 Tests
EUR 886
CtBP1 protein
30R-1495 100 ug
EUR 268
Description: Purified recombinant Human CtBP1 protein
CTBP1 siRNA
20-abx901313
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CTBP1 siRNA
20-abx913059
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CTBP1 siRNA
20-abx913060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CtBP1
YF-PA11172 100 ug
EUR 403
Description: Rabbit polyclonal to CtBP1
anti-CtBP1
YF-PA23537 50 ul
EUR 334
Description: Mouse polyclonal to CtBP1
CtBP1 (Ab-422) Antibody
33281-100ul 100ul
EUR 252
CtBP1 (Ab-422) Antibody
33281-50ul 50ul
EUR 187
CtBP1 (Phospho-Ser422) Antibody
11796-100ul 100ul
EUR 252
CtBP1 (Phospho-Ser422) Antibody
11796-50ul 50ul
EUR 187
Phospho-CTBP1 (Ser422) Antibody
CSB-PA442098-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CTBP1 (Ser422). Recognizes Phospho-CTBP1 (Ser422) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100
Phospho-CTBP1 (Ser422) Antibody
CSB-PA442098-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CTBP1 (Ser422). Recognizes Phospho-CTBP1 (Ser422) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100
CTBP1 (Ab-422) Antibody
CSB-PA278105-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CTBP1 (Ab-422). Recognizes CTBP1 (Ab-422) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
CTBP1 (Ab-422) Antibody
CSB-PA278105-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CTBP1 (Ab-422). Recognizes CTBP1 (Ab-422) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
CtBP1 (Phospho-Ser422) Antibody
20-abx012683
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Phospho-CtBP1(Ser422) Antibody
AF0807 200ul
EUR 304
Description: Phospho-CtBP1(Ser422) Antibody detects endogenous levels of CtBP1 only when phosphorylated at Sersine 422.
Phospho-CTBP1 (S422) Antibody
1-CSB-PA007410
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CTBP1 (S422). Recognizes Phospho-CTBP1 (S422) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
Phospho- CtBP1 (Ser422) Antibody
ABF0807 100 ug
EUR 438
CtBP1/2 (Phospho-Ser158/164) Polyclonal Conjugated Antibody
C12589 100ul
EUR 397
Human CtBP1 Antibody (Biotin Conjugate)
32053-05121 150 ug
EUR 369
CtBP1 / 2 (pS158 / 164) Antibody
abx149594-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
CtBP1 (Ab-422) Conjugated Antibody
C33281 100ul
EUR 397
Anti-Phospho-CtBP1 (S422) antibody
STJ90975 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-CtBP1 (S422).
Anti-CTBP1 Purified
11-511-C100 0.1 mg
EUR 204
CTBP1 Blocking Peptide
DF6568-BP 1mg
EUR 195
CTBP1 Blocking Peptide
20-abx162377
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
CtBP1 Blocking Peptide
AF0795-BP 1mg
EUR 195
CTBP1 cloning plasmid
CSB-CL618772HU1-10ug 10ug
EUR 481
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggcagctcgcacttgctcaacaagggcctgccgcttggcgtccgacctccgatcatgaacgggcccctgcacccgcggcccctggtggcattgctggatggccgggactgcacagtggagatgcccatcctgaaggacgtggccactgtggccttctgcgacgcgcagtcca
  • Show more
Description: A cloning plasmid for the CTBP1 gene.
CTBP1 cloning plasmid
CSB-CL618772HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atgtcaggcgtccgacctccgatcatgaacgggcccctgcacccgcggcccctggtggcattgctggatggccgggactgcacagtggagatgcccatcctgaaggacgtggccactgtggccttctgcgacgcgcagtccacgcaggagatccatgagaaggtcctgaacgagg
  • Show more
Description: A cloning plasmid for the CTBP1 gene.
Anti-CtBP1 (2G7)
YF-MA10207 100 ug
EUR 363
Description: Mouse monoclonal to CtBP1
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human)
4-PAC409Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1)
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), APC
4-PAC409Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with APC.
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), Biotinylated
4-PAC409Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with Biotin.
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), Cy3
4-PAC409Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with Cy3.
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), FITC
4-PAC409Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with FITC.
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), HRP
4-PAC409Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with HRP.
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), PE
4-PAC409Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with PE.
Human CtBP1 AssayLite Antibody (FITC Conjugate)
32053-05141 150 ug
EUR 428
Human CtBP1 AssayLite Antibody (RPE Conjugate)
32053-05151 150 ug
EUR 428
Human CtBP1 AssayLite Antibody (APC Conjugate)
32053-05161 150 ug
EUR 428
Human CtBP1 AssayLite Antibody (PerCP Conjugate)
32053-05171 150 ug
EUR 471
CtBP1/2 (Phospho-Ser158/164) Antibody
12589-100ul 100ul
EUR 252
CtBP1/2 (Phospho-Ser158/164) Antibody
12589-50ul 50ul
EUR 187
Phospho-CtBP1/2 (Ser158/164) Antibody
AF8259 200ul
EUR 376
Description: CtBP1/2 (Phospho-Ser158/164) Antibody detects endogenous levels of CtBP1/2 only when phosphorylated at Ser158/164.
CtBP1/2 (Phospho- Ser158/164) Antibody
ABF8259 100 ug
EUR 438
CtBP1/2 Blocking Peptide
DF10353-BP 1mg
EUR 195
CTBP1 ELISA KIT|Human
EF008896 96 Tests
EUR 689
Rat CTBP1 shRNA Plasmid
20-abx985460
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CtBP1 Cell ELISA Kit
abx595155-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Mouse CTBP1 shRNA Plasmid
20-abx969870
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CTBP1 shRNA Plasmid
20-abx951051
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CTBP1 Recombinant Protein (Human)
RP008278 100 ug Ask for price
CTBP1 Recombinant Protein (Human)
RP008281 100 ug Ask for price
CTBP1 Recombinant Protein (Rat)
RP196622 100 ug Ask for price
CTBP1 Recombinant Protein (Mouse)
RP126458 100 ug Ask for price
CTBP1 Recombinant Protein (Mouse)
RP126461 100 ug Ask for price
CTBP1 Recombinant Protein (Mouse)
RP126464 100 ug Ask for price
CTBP1 Recombinant Protein (Mouse)
RP126467 100 ug Ask for price
Rabbit C terminal binding protein 1(CTBP1) ELISA kit
E04C2144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit C terminal binding protein 1(CTBP1) ELISA kit
E04C2144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit C terminal binding protein 1(CTBP1) ELISA kit
E04C2144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit C terminal binding protein 1(CTBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
C-Terminal Binding Protein 1 (CTBP1) Polyclonal Antibody (Human), APC-Cy7
4-PAC409Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CTBP1 (Met1~Phe250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Terminal Binding Protein 1 (CTBP1). This antibody is labeled with APC-Cy7.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
abx025989-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
abx025989-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx214101
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx111832
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
20-abx121379
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
20-abx126875
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx130699
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
abx145059-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx137368
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CtBP1) Antibody
abx140039-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.
C-Terminal-Binding Protein 1 (CtBP1) Antibody
20-abx012973
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
abx028520-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
abx028520-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx241960
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx242203
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx242239
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
20-abx321412
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
abx331536-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
C-Terminal Binding Protein 1 (CTBP1) Antibody
20-abx328471
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
C-Terminal-Binding Protein 1 (CTBP1) Antibody
abx232046-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Monoclonal CTBP1 Antibody (monoclonal) (M01), Clone: 2G7
AMM03429G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CTBP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G7. This antibody is applicable in WB, IHC and IF, E
C-Terminal-Binding Protein 1 (CTBP1) Antibody
20-abx001431
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Phospho-CtBP1(Ser422) Blocking Peptide
AF0807-BP 1mg
EUR 195
Ctbp1 ORF Vector (Rat) (pORF)
ORF065542 1.0 ug DNA
EUR 506
CTBP1 ORF Vector (Human) (pORF)
ORF002760 1.0 ug DNA
EUR 95
CTBP1 ORF Vector (Human) (pORF)
ORF002761 1.0 ug DNA
EUR 95
Ctbp1 ORF Vector (Mouse) (pORF)
ORF042154 1.0 ug DNA
EUR 506
Ctbp1 ORF Vector (Mouse) (pORF)
ORF042155 1.0 ug DNA
EUR 506
Ctbp1 ORF Vector (Mouse) (pORF)
ORF042156 1.0 ug DNA
EUR 506

CTBP1 Rabbit Polyclonal Antibody