Overexpressed in Serum from Osteoporotic Sufferers and Is Related to Elevated Danger of Bone Fragility

Overexpressed in Serum from Osteoporotic Sufferers and Is Related to Elevated Danger of Bone Fragility

Epitranscriptomic regulation by m A RNA methylation in thoughts development and illnesses


  • Cell RNAs are pervasively tagged with quite a few chemical moieties, collectively often called epitranscriptomic modifications. The methylation of adenosine at N6place generates N6-methyladenosine (m6A), which is basically probably the most ample and reversible epitranscriptomic modification in mammals.
  • The m6A signaling is mediated by a loyal set of proteins comprised of writers, erasers, and readers. Reverse to the activation-repression binary view of gene regulation, rising proof implies that the m6A methylation controls quite a few parts of mRNA metabolism, akin to splicing, export, stability, translation, and degradation, culminating inside the fine-tuning of gene expression.
  • Thoughts reveals the very best abundance of m6A methylation inside the physique, which is developmentally altered. Contained in the thoughts, m6A methylation is biased in direction of neuronal transcripts and delicate to neuronal train.
  • In a healthful thoughts, m6A maintains quite a few developmental and physiological processes akin to neurogenesis, axonal improvement, synaptic plasticity, circadian rhythm, cognitive carry out, and stress response. The m6A imbalance contributes to the pathogenesis of acute and continuous CNS insults, thoughts most cancers, and neuropsychiatric issues.


  • This overview talked about the molecular mechanisms of m6A regulation and its implication inside the developmental, physiological, and pathological processes of the thoughts.

GNAS Complex Locus (GNAS) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gnas Complex Locus (GNAS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS antibody

70R-1643 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-1651 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody

70R-1652 100 ug
EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-12940 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-13520 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-21619 50 ul
EUR 435
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody

32899-100ul 100ul
EUR 252

GNAS antibody

38452-100ul 100ul
EUR 252

GNAS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody

DF7068 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

DF7388 200ul
EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS antibody

70R-5756 50 ug
EUR 467
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody

ABD7068 100 ug
EUR 438

GNAS Antibody

ABD7388 100 ug
EUR 438

GNAS Complex Locus (GNAS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS complex locus (GNAS) polyclonal antibody

ABP-PAB-11314 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

GNAS Conjugated Antibody

C32899 100ul
EUR 397

NESP55,GNAS Antibody

abx235663-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GNAS Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNAS Polyclonal Antibody

A68803 100 ?g
EUR 628.55
Description: Ask the seller for details

GNAS Polyclonal Antibody

A64422 100 µg
EUR 570.55
Description: The best epigenetics products

anti- GNAS antibody

FNab03536 100µg
EUR 505.25
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Gene ID: 2778
  • Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

Anti-GNAS antibody

PAab03536 100 ug
EUR 355

Anti-GNAS antibody

STJ27492 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody

STJ23816 100 µl
EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody

STJ72252 100 µg
EUR 359

Gnas/ Rat Gnas ELISA Kit

ELI-12714r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-27931r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-35065r 96 Tests
EUR 886

Gnas/ Rat Gnas ELISA Kit

ELI-47242r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17793 2 ug
EUR 231

Polyclonal GNAS Antibody (Center)

APR05815G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

GNAS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

anti- NESP55,GNAS antibody

FNab05663 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

Polyclonal GNAS Antibody (C-term)

APR04328G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)

APG00677G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (aa385-394)

APR02185G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5

AMM03034G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7

AMM03035G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal GNAS Antibody (N-Term)

AMM04827G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

GNAS Polyclonal Antibody, HRP Conjugated

A68804 100 ?g
EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated

A68805 100 ?g
EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated

A68806 100 ?g
EUR 628.55
Description: fast delivery possible

GNAS Polyclonal Antibody, HRP Conjugated

A64423 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated

A64424 100 µg
EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated

A64425 100 µg
EUR 570.55
Description: reagents widely cited

GNAS Blocking Peptide

33R-10097 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide

33R-8471 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide

33R-9925 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide

33R-6814 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide

DF7068-BP 1mg
EUR 195

GNAS Blocking Peptide

DF7388-BP 1mg
EUR 195

GNAS cloning plasmid

CSB-CL009596HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid

CSB-CL009596HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1188
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb

A5546-100ul 100 ul
EUR 308

GNAS Rabbit pAb

A5546-200ul 200 ul
EUR 459

GNAS Rabbit pAb

A5546-20ul 20 ul
EUR 183

GNAS Rabbit pAb

A5546-50ul 50 ul
EUR 223

GNAS Rabbit pAb

A2732-100ul 100 ul
EUR 308

GNAS Rabbit pAb

A2732-200ul 200 ul
EUR 459

GNAS Rabbit pAb

A2732-20ul 20 ul
EUR 183

GNAS Rabbit pAb

A2732-50ul 50 ul
EUR 223

Recombinant human GNAS

P1012 100ug Ask for price
  • Uniprot ID: O95467
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m

PVT11671 2 ug
EUR 273


ELI-12712h 96 Tests
EUR 824

Mouse Gnas ELISA KIT

ELI-12713m 96 Tests
EUR 865


ELI-27250d 96 Tests
EUR 928


EF009911 96 Tests
EUR 689

Rat GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNA-Binding Proteins in Most cancers: Sensible and Therapeutic Views


RNA-binding proteins (RBPs) crucially regulate gene expression by post-transcriptional regulation, akin to by modulating microRNA (miRNA) processing and the selection splicing, completely different polyadenylation, subcellular localization, stability, and translation of RNAs. Larger than 1500 RBPs have been acknowledged up to now, and loads of of them are acknowledged to be deregulated in most cancers. Alterations inside the expression and localization of RBPs can have an effect on the expression ranges of oncogenes, tumor-suppressor genes, and genome stability-related genes.

RBP-mediated gene regulation can lead to quite a few cancer-related cell phenotypes, akin to proliferation, apoptosis, angiogenesis, senescence, and epithelial-mesenchymal transition (EMT)/invasion/metastasis. This regulation may be associated to most cancers prognosis.

Thus, RBPs might be potential targets for the occasion of therapeutics for probably the most cancers remedy. On this overview, we describe the molecular options of RBPs, their roles in cancer-related cell phenotypes, and quite a few approaches that might be used to concentrate on RBPs for many cancers remedy.


Circulating Prolonged Non-Coding RNA GAS5 Is Overexpressed in Serum from Osteoporotic Victims and Is Associated to Elevated Hazard of Bone Fragility


Osteoporosis (OP) is a multifactorial dysfunction via which environmental parts along with genetic variants and epigenetic mechanisms have been implicated. Prolonged non-coding RNAs (lncRNAs) have simply these days emerged as important regulators of bone metabolism and OP aetiology.

On this analysis, we analyzed the expression diploma and the genetic affiliation of lncRNA GAS5 in OP victims compared with controls. Quantitative RT-PCR analysis of GAS5 was carried out on the serum of 56 OP victims and 28 healthful folks. OP matters had been divided into three groups of analysis: 29 with fragility fractures of lumbar spine (OP_VF), 14 with fragility fractures of femoral neck (OP_FF) and 13 with out fractures (OP_WF). Genotyping of the rs145204276 insertion/deletion polymorphism has moreover been carried out by Restriction fragment measurement polymorphism (RFLP) and direct sequencing analyses.

Expression of circulating GAS5 is significantly elevated in OP victims compared with controls (p < 0.01), with a statistically higher significance in fractured OP folks vs. healthful matters (p < 0.001). No statistically vital change was current in female OP victims; conversely, GAS5 is upregulated inside the subgroup of fractured OP women sera (p < 0.01) and in all OP males (p < 0.05). Furthermore, a direct correlation between GAS5 expression diploma and parathyroid hormone (PTH) focus was current in OP victims (r = 0.2930; p = 0.0389).

Genetic analysis of rs145204276 revealed that the deletion allele was correlated with the subsequent expression of GAS5 in OP victims (0.22 ± 0.02 vs. 0.15 ± 0.01, ** p < 0.01). Our outcomes suggest circulating GAS5 as a putative biomarker for the prognosis and prognosis of OP and OP-related fractures.


Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit

RD-SOX2-Ra-96Tests 96 Tests
EUR 709

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit

RDR-SOX2-Ra-48Tests 48 Tests
EUR 534

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit

RDR-SOX2-Ra-96Tests 96 Tests
EUR 742

SOX2 Antibody

25044-100ul 100ul
EUR 390

Sox2 antibody

20R-1751 100 ug
EUR 673
Description: Rabbit polyclonal Sox2 antibody

SOX2 antibody

20R-2500 50 ug
EUR 281
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody

21425-100ul 100ul
EUR 252

SOX2 Antibody

21425-50ul 50ul
EUR 187

SOX2 Antibody

31128-100ul 100ul
EUR 252

SOX2 Antibody

31128-50ul 50ul
EUR 187

SOX2 antibody

70R-12166 100 ug
EUR 403
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody

70R-20460 50 ul
EUR 435
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody

48128-100ul 100ul
EUR 333

SOX2 Antibody

48128-50ul 50ul
EUR 239

SOX2 antibody

38134-100ul 100ul
EUR 252

SOX2 antibody

10R-11127 100 ug
EUR 349
Description: Mouse monoclonal SOX2 antibody

SOX2 Antibody

43142-100ul 100ul
EUR 252

SOX2 Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody

CSB-PA982860-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SOX2 Antibody

DF6109 200ul
EUR 304
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

SOX2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Sox2 antibody

70R-SR013 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal Sox2 antibody

SOX2 antibody

70R-33158 100 ug
EUR 435
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody

70R-33160 100 ug
EUR 435
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody

AF4010 200ul
EUR 376
Description: The antibody detects endogenous level of total SOX2 protein.

SOX2 Antibody

AF5140 200ul
EUR 304
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody

BF0481 200ul
EUR 376
Description: SOX2 antibody detects endogenous levels of total SOX2.

SOX2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, IF

sox2 Antibody

AF7950 200ul
EUR 376
Description: sox2 Antibody detects endogenous levels of sox2.

SOX2 Antibody

ABD6109 100 ug
EUR 438

SOX2 Antibody

ABF4010 100 ug
EUR 438

SOX2 Antibody

ABF5140 100 ug
EUR 438

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNUM1791-50 50uL
EUR 395
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNUM1792-50 50uL
EUR 395
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNUB1791-100 100uL
EUR 209
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNUB1791-500 500uL
EUR 458
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNUB1792-100 100uL
EUR 209
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNUB1792-500 500uL
EUR 458
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC551791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC551791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC551792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC551792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC611791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC611791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC611792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC611792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC471791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC471791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC471792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC471792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC051791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC051791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC051792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC051792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC401791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC401791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC401792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC401792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC431791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC431791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC431792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC431792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC041791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC041791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC041792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC041792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC701791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC701791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC701792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC701792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC801791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC801791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC801792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC801792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCH1791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCH1791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCH1792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCH1792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCP1791-250 250uL
EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCP1792-250 250uL
EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCR1791-250 250uL
EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCR1792-250 250uL
EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC941791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC941791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC941792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC941792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCA1791-250 250uL
EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCA1792-250 250uL
EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCB1791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCB1791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCB1792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCB1792-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC881791-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC881791-500 500uL
EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC881792-100 100uL
EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL